Regulon of Zur in Oenococcus oeni PSU-1

Properties
Regulator type:	Transcription factor
TF locus tag:	OEOE_1189
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Lactobacillaceae
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 43 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -95 Score: 5.4 Sequence: TTAATGGTAAATATTACTTTTAC Position: -53 Score: 6 Sequence: TACTTAGTAATGATTACTTGTTA Locus tag: OEOE_1189 Name: zur Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
	OEOE_1189	zur	Zinc homeostasis transcriptional regulator Zur, Fur family
Position: -42 Score: 6.6 Sequence: TAAATAGTAATAATTACTTTTAA Locus tag: OEOE_0084 Name: lp_0947 Funciton: Conserved hypothetical protein
	OEOE_0084	lp_0947	Conserved hypothetical protein
Position: -118 Score: 6 Sequence: TAACAAGTAATCATTACTAAGTA Position: -76 Score: 5.5 Sequence: GTAAAAGTAATATTTACCATTAA Locus tag: OEOE_1188 Name: znuA Funciton: Zinc ABC transporter, substrate-binding protein Locus tag: OEOE_1187 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein
	OEOE_1188	znuA	Zinc ABC transporter, substrate-binding protein
	OEOE_1187	znuC	Zinc ABC transporter, ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD