Regulon of Zur in Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Properties
Regulator type:	Transcription factor
TF locus tag:	LEUM_0802
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Lactobacillaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 43 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -65 Score: 6.1 Sequence: TAAATAGTAATAATTACTATAAT Position: -43 Score: 6.7 Sequence: TTAAAAGTAATTGTTACTATTTA Locus tag: LEUM_0082 Name: lp_0947 Funciton: Conserved hypothetical protein
	LEUM_0082	lp_0947	Conserved hypothetical protein
Position: -171 Score: 6.2 Sequence: TTTAAAGTAATCATTACTTTTTG Position: -142 Score: 6.2 Sequence: TTAATAGTAATGATTACTATAAT Locus tag: LEUM_0803 Name: znuA Funciton: Zinc ABC transporter, substrate-binding protein Locus tag: LEUM_0804 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein Locus tag: LEUM_0805 Name: znuB Funciton: Zinc ABC transporter, permease protein
	LEUM_0803	znuA	Zinc ABC transporter, substrate-binding protein
	LEUM_0804	znuC	Zinc ABC transporter, ATP-binding protein
	LEUM_0805	znuB	Zinc ABC transporter, permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD