Regulon of Zur in Lactobacillus salivarius subsp. salivarius UCC118

Properties
Regulator type:	Transcription factor
TF locus tag:	LSL_1450
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Lactobacillaceae
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 43 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -63 Score: 5.7 Sequence: TAAATCGTAATTGATATCATTTA Position: -42 Score: 7.3 Sequence: TAAAAAGTAATGATTACTATTTA Locus tag: LSL_1944 Name: rpsN2 Funciton: Small subunit ribosomal protein S14, zinc-independent Locus tag: LSL_1943 Name: lp_0947 Funciton: Conserved hypothetical protein
	LSL_1944	rpsN2	Small subunit ribosomal protein S14, zinc-independent
	LSL_1943	lp_0947	Conserved hypothetical protein
Position: -35 Score: 6.6 Sequence: TAGAAAGTAAAGATTACTATTTA Locus tag: LSL_1450 Name: zur Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
	LSL_1450	zur	Zinc homeostasis transcriptional regulator Zur, Fur family
Position: -40 Score: 7 Sequence: TAAAAAGTAATGATTACTATATA Locus tag: LSL_1587 Name: znuA Funciton: Zinc ABC transporter, substrate-binding protein Locus tag: LSL_1586 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein Locus tag: LSL_1585 Name: znuB Funciton: Zinc ABC transporter, permease protein
	LSL_1587	znuA	Zinc ABC transporter, substrate-binding protein
	LSL_1586	znuC	Zinc ABC transporter, ATP-binding protein
	LSL_1585	znuB	Zinc ABC transporter, permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD