Regulon of Zur in Lactobacillus sakei subsp. sakei 23K

Properties
Regulator type:	Transcription factor
TF locus tag:	LSA0109
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Lactobacillaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 43 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -37 Score: 6.5 Sequence: TAAAGCGTAACTATTACGATTTA Locus tag: LSA0282 Name: znuA Funciton: Zinc ABC transporter, substrate-binding protein Locus tag: LSA0283 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein Locus tag: LSA0284 Name: znuB Funciton: Zinc ABC transporter, permease protein
	LSA0282	znuA	Zinc ABC transporter, substrate-binding protein
	LSA0283	znuC	Zinc ABC transporter, ATP-binding protein
	LSA0284	znuB	Zinc ABC transporter, permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD