Regulon of Zur in Lactobacillus sakei subsp. sakei 23K
Regulator type: | Transcription factor |
TF locus tag: | LSA0109 |
Regulator family: | FUR |
Regulation mode: | repressor |
Biological process: | Zinc homeostasis |
Effector: | Zinc ion, (Zn2+) |
Regulog: | Zur - Lactobacillaceae |
Statistics of regulated genes: | |
- Genes | 3 |
- Operons | 1 |
Visualization: | |
![]() |
Allows to visualize regulon content in the context of metabolic pathways |

Member of regulog collections
- By taxonomy - Lactobacillaceae
- By trascription factor - Zur
- By TF family - FUR
- By effector - Zinc ion, (Zn2+)
- By pathway - Zinc homeostasis
Locus Tag | Name | Function | |
---|---|---|---|
Position: -37
Score: 6.5 Sequence: TAAAGCGTAACTATTACGATTTA
Locus tag: LSA0282
Name: znuA Funciton: Zinc ABC transporter, substrate-binding protein
Locus tag: LSA0283
Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein
Locus tag: LSA0284
Name: znuB Funciton: Zinc ABC transporter, permease protein |
|||
znuA
|
Zinc ABC transporter, substrate-binding protein
|
||
znuC
|
Zinc ABC transporter, ATP-binding protein
|
||
znuB
|
Zinc ABC transporter, permease protein
|
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |