Regulon of Zur in Lactobacillus rhamnosus GG

Properties
Regulator type:	Transcription factor
TF locus tag:	LGG_02012
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Lactobacillaceae
Statistics of regulated genes:
- Genes	5
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 43 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -243 Score: 6.8 Sequence: TTAAGCGTAATGATTACGATTTA Locus tag: LGG_02422 Name: rpsN2 Funciton: Small subunit ribosomal protein S14, zinc-independent
	LGG_02422	rpsN2	Small subunit ribosomal protein S14, zinc-independent
Position: -181 Score: 6.7 Sequence: TAAATCGTAATCATTACGCTTAA Position: -40 Score: 6.9 Sequence: TAAATCGTAATGATTACGTTTTG Locus tag: LGG_02423 Name: znuA Funciton: Zinc ABC transporter, substrate-binding protein
	LGG_02423	znuA	Zinc ABC transporter, substrate-binding protein
Position: -70 Score: 5.4 Sequence: CTAATCGTAACCAGTACGATTTG Locus tag: LGG_02012 Name: zur Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
	LGG_02012	zur	Zinc homeostasis transcriptional regulator Zur, Fur family
Position: -39 Score: 6.4 Sequence: TAAATCGTAATCGTTACCGTTTG Locus tag: LGG_00285 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein Locus tag: LGG_00286 Name: znuB Funciton: Zinc ABC transporter, permease protein
	LGG_00285	znuC	Zinc ABC transporter, ATP-binding protein
	LGG_00286	znuB	Zinc ABC transporter, permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD