Regulon of Zur in Lactobacillus reuteri JCM 1112

Properties
Regulator type:	Transcription factor
TF locus tag:	LAR_1528
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Lactobacillaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 43 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -9 Score: 5.3 Sequence: TAAAAAGTAATGTTAACTTTAAG Locus tag: LAR_0209 Name: znuB Funciton: Zinc ABC transporter, permease protein
	LAR_0209	znuB	Zinc ABC transporter, permease protein
Position: -36 Score: 6.8 Sequence: TAAATAGTAACGATTACGATTAA Locus tag: LAR_0207 Name: znuA Funciton: Zinc ABC transporter, substrate-binding protein Locus tag: LAR_0208 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein
	LAR_0207	znuA	Zinc ABC transporter, substrate-binding protein
	LAR_0208	znuC	Zinc ABC transporter, ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD