Regulon of Zur in Lactobacillus plantarum WCFS1

Properties
Regulator type:	Transcription factor
TF locus tag:	lp_0868
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Lactobacillaceae
Statistics of regulated genes:
- Genes	7
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 43 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -44 Score: 6.6 Sequence: TTAACAGTAATGGTTACGATTTA Locus tag: lp_3302 Name: znuA Funciton: Zinc ABC transporter, substrate-binding protein
	lp_3302	znuA	Zinc ABC transporter, substrate-binding protein
Position: -51 Score: 6.9 Sequence: AAAATAGTAATCATTACGATTTA Locus tag: lp_0463 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein Locus tag: lp_0464 Name: znuB Funciton: Zinc ABC transporter, permease protein
	lp_0463	znuC	Zinc ABC transporter, ATP-binding protein
	lp_0464	znuB	Zinc ABC transporter, permease protein
Position: -88 Score: 6.8 Sequence: TAAAACGTAAATATTACTATTTA Position: -39 Score: 7.3 Sequence: TAAAACGTAATGATTACTATTTA Locus tag: lp_3018 Name: znuA Funciton: Zinc ABC transporter, substrate-binding protein
	lp_3018	znuA	Zinc ABC transporter, substrate-binding protein
Position: -125 Score: 5.6 Sequence: AAAATAGTAGCTGTTACGATTTA Locus tag: lp_2216 Name: rpsN2 Funciton: Small subunit ribosomal protein S14, zinc-independent
	lp_2216	rpsN2	Small subunit ribosomal protein S14, zinc-independent
Position: -36 Score: 6.7 Sequence: TAAATGGTAATAATTACTATTTA Locus tag: lp_0947 Name: lp_0947 Funciton: Conserved hypothetical protein
	lp_0947	lp_0947	Conserved hypothetical protein
Position: -56 Score: 6.9 Sequence: TAAATAGTAATGATTATGATTTA Locus tag: lp_0868 Name: zur Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
	lp_0868	zur	Zinc homeostasis transcriptional regulator Zur, Fur family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD