Regulon of Zur in Lactobacillus casei ATCC 334

Properties
Regulator type:	Transcription factor
TF locus tag:	LSEI_2025
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Lactobacillaceae
Statistics of regulated genes:
- Genes	6
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 43 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -69 Score: 6.5 Sequence: TTAATCGTAATCAATACGATTTA Locus tag: LSEI_2025 Name: zur Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
	LSEI_2025	zur	Zinc homeostasis transcriptional regulator Zur, Fur family
Position: -183 Score: 7 Sequence: TAATTCGTAATCATTACTATTTA Position: -40 Score: 6.7 Sequence: TAAATCGTAATTATTACGTTTTG Locus tag: LSEI_2427 Name: znuA Funciton: Zinc ABC transporter, substrate-binding protein
	LSEI_2427	znuA	Zinc ABC transporter, substrate-binding protein
Position: -248 Score: 6.9 Sequence: TAAATAGTAATGATTACGAATTA Locus tag: LSEI_2425 Name: rpsN2 Funciton: Small subunit ribosomal protein S14, zinc-independent
	LSEI_2425	rpsN2	Small subunit ribosomal protein S14, zinc-independent
Position: -183 Score: 6.4 Sequence: CAAAACGTAATAATTACGATTTA Position: -40 Score: 6.9 Sequence: TAAATAGTAATGATTACGAATTA Locus tag: LSEI_2426 Name: lp_0947 Funciton: Conserved hypothetical protein
	LSEI_2426	lp_0947	Conserved hypothetical protein
Position: -39 Score: 6.4 Sequence: TAAACCGTAATCGTTACCGTTTA Locus tag: LSEI_0242 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein Locus tag: LSEI_0243 Name: znuB Funciton: Zinc ABC transporter, permease protein
	LSEI_0242	znuC	Zinc ABC transporter, ATP-binding protein
	LSEI_0243	znuB	Zinc ABC transporter, permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD