Regulon of Zur in Lactobacillus brevis ATCC 367

Properties
Regulator type:	Transcription factor
TF locus tag:	LVIS_1778
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Lactobacillaceae
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 43 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -37 Score: 5.9 Sequence: TAAAGCGTAATAATTACTATCAA Locus tag: LVIS_0360 Name: rpsN2 Funciton: Small subunit ribosomal protein S14, zinc-independent
	LVIS_0360	rpsN2	Small subunit ribosomal protein S14, zinc-independent
Position: -46 Score: 6.6 Sequence: TAAACGGTAATCATTACTGTTTA Locus tag: LVIS_0470 Name: znuA Funciton: Zinc ABC transporter, substrate-binding protein Locus tag: LVIS_0471 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein Locus tag: LVIS_0472 Name: znuB Funciton: Zinc ABC transporter, permease protein
	LVIS_0470	znuA	Zinc ABC transporter, substrate-binding protein
	LVIS_0471	znuC	Zinc ABC transporter, ATP-binding protein
	LVIS_0472	znuB	Zinc ABC transporter, permease protein
Position: -41 Score: 6.8 Sequence: TAAATAGTAATAATTACCATTTA Locus tag: LVIS_0566 Name: znuA Funciton: Zinc ABC transporter, substrate-binding protein
	LVIS_0566	znuA	Zinc ABC transporter, substrate-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD