Regulon of PaaR in Burkholderia phymatum STM815

Properties
Regulator type:	Transcription factor
TF locus tag:	Bphy_2863
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Regulog:	PaaR - Burkholderia
Statistics of regulated genes:
- Genes	13
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 27 sites [see more]

Member of regulog collections

By trascription factor - PaaR
By taxonomy - Burkholderia
By TF family - TetR
By effector - Phenylacetyl-CoA
By pathway - Phenylacetic acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -68 Score: 6.6 Sequence: ACCAACCAACCGGTCGGTCAAT Locus tag: Bphy_2689 Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ Locus tag: Bphy_2690 Name: paaJ Funciton: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-) Locus tag: Bphy_2691 Name: paaF Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) Locus tag: Bphy_2692 Name: paaY Funciton: thioesterase superfamily protein Locus tag: Bphy_2693 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
	Bphy_2689	paaZ	Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
	Bphy_2690	paaJ	Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
	Bphy_2691	paaF	Enoyl-CoA hydratase (EC 4.2.1.17)
	Bphy_2692	paaY	thioesterase superfamily protein
	Bphy_2693	paaK	Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Position: -90 Score: 6.9 Sequence: ATTGACCGACCGGTTGGTTGGT Locus tag: Bphy_2688 Name: paaG Funciton: Enoyl-CoA hydratase (EC 4.2.1.17)
	Bphy_2688	paaG	Enoyl-CoA hydratase (EC 4.2.1.17)
Position: -66 Score: 6.8 Sequence: ATTAACCGACCGGACGGTTGGT Locus tag: Bphy_2857 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: Bphy_2858 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: Bphy_2859 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: Bphy_2860 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: Bphy_2861 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) Locus tag: Bphy_2862 Name: paaW Funciton: Protein of unknown function DUF3658/DUF1835 Locus tag: Bphy_2863 Name: paaR Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
	Bphy_2857	paaA	Phenylacetate-CoA oxygenase, PaaA subunit
	Bphy_2858	paaB	Phenylacetate-CoA oxygenase, PaaB subunit
	Bphy_2859	paaC	Phenylacetate-CoA oxygenase, PaaC subunit
	Bphy_2860	paaD	Phenylacetate-CoA oxygenase, PaaD subunit
	Bphy_2861	paaE	Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
	Bphy_2862	paaW	Protein of unknown function DUF3658/DUF1835
	Bphy_2863	paaR	Transcriptional regulator of phenylacetic acid degradation, TetR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD