Regulon of PaaR in Burkholderia vietnamiensis G4

Properties
Regulator type:	Transcription factor
TF locus tag:	Bcep1808_0306
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Regulog:	PaaR - Burkholderia
Statistics of regulated genes:
- Genes	16
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 27 sites [see more]

Member of regulog collections

By trascription factor - PaaR
By taxonomy - Burkholderia
By TF family - TetR
By effector - Phenylacetyl-CoA
By pathway - Phenylacetic acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -61 Score: 6.6 Sequence: ATCTACCGACCGGTCGGTTTAT Locus tag: Bcep1808_5069 Name: paaH Funciton: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) Locus tag: Bcep1808_5068 Name: paaK2 Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) Locus tag: Bcep1808_5067 Name: paaF2 Funciton: Enoyl-CoA hydratase (EC 4.2.1.17)
	Bcep1808_5069	paaH	3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
	Bcep1808_5068	paaK2	Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
	Bcep1808_5067	paaF2	Enoyl-CoA hydratase (EC 4.2.1.17)
Position: -63 Score: 6.4 Sequence: TCCGACCAACCGGTCGGTTAAT Locus tag: Bcep1808_0520 Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ Locus tag: Bcep1808_0519 Name: paaJ Funciton: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-) Locus tag: Bcep1808_0518 Name: paaF Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) Locus tag: Bcep1808_0517 Name: paaY Funciton: thioesterase superfamily protein Locus tag: Bcep1808_0516 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
	Bcep1808_0520	paaZ	Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
	Bcep1808_0519	paaJ	Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
	Bcep1808_0518	paaF	Enoyl-CoA hydratase (EC 4.2.1.17)
	Bcep1808_0517	paaY	thioesterase superfamily protein
	Bcep1808_0516	paaK	Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Position: -88 Score: 6.6 Sequence: ATTAACCGACCGGTTGGTCGGA Locus tag: Bcep1808_0521 Name: paaG Funciton: Enoyl-CoA hydratase (EC 4.2.1.17)
	Bcep1808_0521	paaG	Enoyl-CoA hydratase (EC 4.2.1.17)
Position: -62 Score: 7.1 Sequence: ATTAACCGACCGGTCGGTTGGT Locus tag: Bcep1808_0312 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: Bcep1808_0311 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: Bcep1808_0310 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: Bcep1808_0309 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: Bcep1808_0308 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) Locus tag: Bcep1808_0307 Name: paaW Funciton: Protein of unknown function DUF3658/DUF1835 Locus tag: Bcep1808_0306 Name: paaR Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
	Bcep1808_0312	paaA	Phenylacetate-CoA oxygenase, PaaA subunit
	Bcep1808_0311	paaB	Phenylacetate-CoA oxygenase, PaaB subunit
	Bcep1808_0310	paaC	Phenylacetate-CoA oxygenase, PaaC subunit
	Bcep1808_0309	paaD	Phenylacetate-CoA oxygenase, PaaD subunit
	Bcep1808_0308	paaE	Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
	Bcep1808_0307	paaW	Protein of unknown function DUF3658/DUF1835
	Bcep1808_0306	paaR	Transcriptional regulator of phenylacetic acid degradation, TetR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of PaaR in Burkholderia vietnamiensis G4

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --