Regulon of PaaR in Burkholderia pseudomallei K96243

Properties
Regulator type:	Transcription factor
TF locus tag:	BPSL3236
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Regulog:	PaaR - Burkholderia
Statistics of regulated genes:
- Genes	13
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 27 sites [see more]

Member of regulog collections

By trascription factor - PaaR
By taxonomy - Burkholderia
By TF family - TetR
By effector - Phenylacetyl-CoA
By pathway - Phenylacetic acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -64 Score: 6.4 Sequence: TCCGACCAACCGGTCGGTTAAT Locus tag: BPSL3041 Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ Locus tag: BPSL3042 Name: paaJ Funciton: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-) Locus tag: BPSL3043 Name: paaF Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) Locus tag: BPSL3044 Name: paaY Funciton: thioesterase superfamily protein Locus tag: BPSL3045 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
	BPSL3041	paaZ	Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
	BPSL3042	paaJ	Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
	BPSL3043	paaF	Enoyl-CoA hydratase (EC 4.2.1.17)
	BPSL3044	paaY	thioesterase superfamily protein
	BPSL3045	paaK	Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Position: -70 Score: 6.6 Sequence: ATTAACCGACCGGTTGGTCGGA Locus tag: BPSL3040 Name: paaG Funciton: Enoyl-CoA hydratase (EC 4.2.1.17)
	BPSL3040	paaG	Enoyl-CoA hydratase (EC 4.2.1.17)
Position: -62 Score: 7.1 Sequence: ATTAACCGACCGGTCGGTTGGT Locus tag: BPSL3230 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: BPSL3231 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: BPSL3232 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: BPSL3233 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: BPSL3234 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) Locus tag: BPSL3235 Name: paaW Funciton: Protein of unknown function DUF3658/DUF1835 Locus tag: BPSL3236 Name: paaR Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
	BPSL3230	paaA	Phenylacetate-CoA oxygenase, PaaA subunit
	BPSL3231	paaB	Phenylacetate-CoA oxygenase, PaaB subunit
	BPSL3232	paaC	Phenylacetate-CoA oxygenase, PaaC subunit
	BPSL3233	paaD	Phenylacetate-CoA oxygenase, PaaD subunit
	BPSL3234	paaE	Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
	BPSL3235	paaW	Protein of unknown function DUF3658/DUF1835
	BPSL3236	paaR	Transcriptional regulator of phenylacetic acid degradation, TetR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD