Regulon of IscR2 in Granulibacter bethesdensis CGDNIH1

Properties
Regulator type:	Transcription factor
TF locus tag:	GbCGDNIH1_1326
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR2 - Rhodospirillales
Statistics of regulated genes:
- Genes	8
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By trascription factor - IscR
By taxonomy - Rhodospirillales
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -27 Score: 6.5 Sequence: AAACAGGACTTAATTGGTCCAGTTA Locus tag: GbCGDNIH1_1326 Name: iscR2 Funciton: Iron-sulfur cluster regulator IscR Locus tag: GbCGDNIH1_1325 Name: sufB Funciton: Iron-sulfur cluster assembly protein SufB Locus tag: GbCGDNIH1_1324 Name: sufC Funciton: Iron-sulfur cluster assembly ATPase protein SufC Locus tag: GbCGDNIH1_1323 Name: sufD Funciton: Iron-sulfur (Fe-S) assembly protein SufD Locus tag: GbCGDNIH1_1322 Name: sufS Funciton: cysteine desulfurase SufS Locus tag: GbCGDNIH1_1321 Name: sufE2 Funciton: Putative iron-sulfur cluster assembly scaffold protein for SUF system, SufE2 Locus tag: GbCGDNIH1_1320 Name: sufT Funciton: Iron sulfur cluster assembly protein SufT Locus tag: GbCGDNIH1_1319 Name: sufA Funciton: Iron binding protein SufA for iron-sulfur cluster assembly
	GbCGDNIH1_1326	iscR2	Iron-sulfur cluster regulator IscR
	GbCGDNIH1_1325	sufB	Iron-sulfur cluster assembly protein SufB
	GbCGDNIH1_1324	sufC	Iron-sulfur cluster assembly ATPase protein SufC
	GbCGDNIH1_1323	sufD	Iron-sulfur (Fe-S) assembly protein SufD
	GbCGDNIH1_1322	sufS	cysteine desulfurase SufS
	GbCGDNIH1_1321	sufE2	Putative iron-sulfur cluster assembly scaffold protein for SUF system, SufE2
	GbCGDNIH1_1320	sufT	Iron sulfur cluster assembly protein SufT
	GbCGDNIH1_1319	sufA	Iron binding protein SufA for iron-sulfur cluster assembly

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD