Regulon of DvMF_2930 in Desulfovibrio vulgaris str. Miyazaki F

Properties
Regulator type:	Transcription factor
TF locus tag:	DvMF_2930
Regulator family:	GntR/Others
Regulation mode:
Biological process:
Effector:
Regulog:	DvMF_2930 - Desulfovibrionales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - GntR/Others

Regulated operons
	Locus Tag	Name	Function
Position: -54 Score: 5.6 Sequence: TCGGGCATTGACGATGCAACG Locus tag: DvMF_2925 Name: null Funciton: 5-carboxymethyl-2-hydroxymuconate delta-isomerase( EC:5.3.3.10 )
	DvMF_2925		5-carboxymethyl-2-hydroxymuconate delta-isomerase( EC:5.3.3.10 )
Position: -59 Score: 6.3 Sequence: TTTTGCATTCTGCATGCAAAA Locus tag: DvMF_2930 Name: null Funciton: transcriptional regulator, GntR family
	DvMF_2930		transcriptional regulator, GntR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD