Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Regulog DvMF_2930 - Desulfovibrionales

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process:
Effector:
Phylum: Proteobacteria/delta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Desulfohalobium retbaense DSM 5692
Desulfomicrobium baculatum DSM 4028
Desulfovibrio desulfuricans G20
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
Desulfovibrio magneticus RS-1
Desulfovibrio piger ATCC 29098
Desulfovibrio salexigens DSM 2638
Desulfovibrio vulgaris Hildenborough
Desulfovibrio vulgaris str. Miyazaki F 2 2
Lawsonia intracellularis PHE/MN1-00
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
DvMF_2925
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_1940: 5-carboxymethyl-2-hydroxymuconate delta-isomerase( EC:5.3.3.10 )
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20

Gene: Dde_1138: 5-carboxymethyl-2-hydroxymuconate delta-isomerase( EC:5.3.3.10 )
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1

Gene: DMR_37950: 5-carboxymethyl-2-hydroxymuconate delta-isomerase( EC:5.3.3.10 )
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_1265: 5-carboxymethyl-2-hydroxymuconate delta-isomerase( EC:5.3.3.10 )
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0875: 5-carboxymethyl-2-hydroxymuconate delta-isomerase( EC:5.3.3.10 )
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -54
score = 5.57132
sequence = TCGGGCATTGACGATGCAACG

Gene: DvMF_2925: 5-carboxymethyl-2-hydroxymuconate delta-isomerase( EC:5.3.3.10 )
 
Lawsonia intracellularis PHE/MN1-00

Gene: LI0820: 5-carboxymethyl-2-hydroxymuconate delta-isomerase( EC:5.3.3.10 )
5-carboxymethyl-2-hydroxymuconate delta-isomerase( EC:5.3.3.10 )
 
CRON 2.
DvMF_2930
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -59
score = 6.34075
sequence = TTTTGCATTCTGCATGCAAAA

Gene: DvMF_2930: transcriptional regulator, GntR family
 
Lawsonia intracellularis PHE/MN1-00
transcriptional regulator, GntR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD
© 2009-2020 RegPrecise