Regulog DvMF_2930 - Desulfovibrionales
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | |
| Effector: | |
| Phylum: | Proteobacteria/delta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Desulfovibrionales
- By TF family - GntR/Others
| Genome | Genes | Operons |
|---|---|---|
| Desulfohalobium retbaense DSM 5692 | ||
| Desulfomicrobium baculatum DSM 4028 | ||
| Desulfovibrio desulfuricans G20 | ||
| Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 | ||
| Desulfovibrio magneticus RS-1 | ||
| Desulfovibrio piger ATCC 29098 | ||
| Desulfovibrio salexigens DSM 2638 | ||
| Desulfovibrio vulgaris Hildenborough | ||
| Desulfovibrio vulgaris str. Miyazaki F | 2 | 2 |
| Lawsonia intracellularis PHE/MN1-00 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| DvMF_2925 |
Gene: Dret_1940: 5-carboxymethyl-2-hydroxymuconate delta-isomerase( EC:5.3.3.10 ) |
|
Gene: Dde_1138: 5-carboxymethyl-2-hydroxymuconate delta-isomerase( EC:5.3.3.10 ) |
|
Gene: DMR_37950: 5-carboxymethyl-2-hydroxymuconate delta-isomerase( EC:5.3.3.10 ) |
|
Gene: Desal_1265: 5-carboxymethyl-2-hydroxymuconate delta-isomerase( EC:5.3.3.10 ) |
Gene: DVU0875: 5-carboxymethyl-2-hydroxymuconate delta-isomerase( EC:5.3.3.10 ) |
*
Desulfovibrio vulgaris str. Miyazaki F Site: position = -54 score = 5.57132 sequence = TCGGGCATTGACGATGCAACG Gene: DvMF_2925: 5-carboxymethyl-2-hydroxymuconate delta-isomerase( EC:5.3.3.10 ) |
Gene: LI0820: 5-carboxymethyl-2-hydroxymuconate delta-isomerase( EC:5.3.3.10 ) |
5-carboxymethyl-2-hydroxymuconate delta-isomerase( EC:5.3.3.10 ) |
| CRON 2. | |||||||||||
| DvMF_2930 |
|
|
|
|
|
|
|
|
*
Desulfovibrio vulgaris str. Miyazaki F Site: position = -59 score = 6.34075 sequence = TTTTGCATTCTGCATGCAAAA Gene: DvMF_2930: transcriptional regulator, GntR family |
|
transcriptional regulator, GntR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |