Profile of regulator DvMF_2930 in Desulfovibrionales
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | |
| Effector: | |
| Regulog: | DvMF_2930 - Desulfovibrionales |
Member of regulog collections
- By taxonomy - Desulfovibrionales
- By TF family - GntR/Others
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Desulfovibrio vulgaris str. Miyazaki F | |||||
| DvMF_2930 | null | -59 | 6.3 | TTTTGCATTCTGCATGCAAAA | |
| DvMF_2925 | null | -54 | 5.6 | TCGGGCATTGACGATGCAACG | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |