Regulon of DvMF_1479 in Desulfovibrio vulgaris str. Miyazaki F
| Regulator type: | Transcription factor |
| TF locus tag: | DvMF_1479 |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Amino acid transport |
| Effector: | |
| Regulog: | DvMF_1479 - Desulfovibrionales |
| Statistics of regulated genes: | |
| - Genes | 6 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Desulfovibrionales
- By TF family - GntR/Others
- By pathway - Amino acid transport
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -93
Score: 6.4 Sequence: CTTTGTATACGGTATGCAACG
Locus tag: DvMF_1483
Name: null Funciton: putative ABC transporter permease protein
Locus tag: DvMF_1482
Name: null Funciton: Branched-chain amino acid transport system permease protein LivM (TC 3.A.1.4.1)
Locus tag: DvMF_1481
Name: null Funciton: Branched-chain amino acid transport ATP-binding protein LivG (TC 3.A.1.4.1)
Locus tag: DvMF_1480
Name: null Funciton: Branched-chain amino acid transport ATP-binding protein LivF (TC 3.A.1.4.1)
Locus tag: DvMF_1479
Name: null Funciton: Transcriptional regulator, GntR family
Locus tag: DvMF_1478
Name: null Funciton: putative ABC transporter substrate binding protein precursor |
|||
|
putative ABC transporter permease protein
|
|||
|
Branched-chain amino acid transport system permease protein LivM (TC 3.A.1.4.1)
|
|||
|
Branched-chain amino acid transport ATP-binding protein LivG (TC 3.A.1.4.1)
|
|||
|
Branched-chain amino acid transport ATP-binding protein LivF (TC 3.A.1.4.1)
|
|||
|
Transcriptional regulator, GntR family
|
|||
|
putative ABC transporter substrate binding protein precursor
|
|||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |