Regulon of DvMF_1479 in Desulfovibrio vulgaris str. Miyazaki F

Properties
Regulator type:	Transcription factor
TF locus tag:	DvMF_1479
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Amino acid transport
Effector:
Regulog:	DvMF_1479 - Desulfovibrionales
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - GntR/Others
By pathway - Amino acid transport

Regulated operons
	Locus Tag	Name	Function
Position: -93 Score: 6.4 Sequence: CTTTGTATACGGTATGCAACG Locus tag: DvMF_1483 Name: null Funciton: putative ABC transporter permease protein Locus tag: DvMF_1482 Name: null Funciton: Branched-chain amino acid transport system permease protein LivM (TC 3.A.1.4.1) Locus tag: DvMF_1481 Name: null Funciton: Branched-chain amino acid transport ATP-binding protein LivG (TC 3.A.1.4.1) Locus tag: DvMF_1480 Name: null Funciton: Branched-chain amino acid transport ATP-binding protein LivF (TC 3.A.1.4.1) Locus tag: DvMF_1479 Name: null Funciton: Transcriptional regulator, GntR family Locus tag: DvMF_1478 Name: null Funciton: putative ABC transporter substrate binding protein precursor
	DvMF_1483		putative ABC transporter permease protein
	DvMF_1482		Branched-chain amino acid transport system permease protein LivM (TC 3.A.1.4.1)
	DvMF_1481		Branched-chain amino acid transport ATP-binding protein LivG (TC 3.A.1.4.1)
	DvMF_1480		Branched-chain amino acid transport ATP-binding protein LivF (TC 3.A.1.4.1)
	DvMF_1479		Transcriptional regulator, GntR family
	DvMF_1478		putative ABC transporter substrate binding protein precursor

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD