Profile of regulator DvMF_1479 in Desulfovibrionales
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Amino acid transport |
| Effector: | |
| Regulog: | DvMF_1479 - Desulfovibrionales |
Member of regulog collections
- By taxonomy - Desulfovibrionales
- By TF family - GntR/Others
- By pathway - Amino acid transport
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Desulfovibrio vulgaris str. Miyazaki F | |||||
| DvMF_1483 | null | -93 | 6.4 | CTTTGTATACGGTATGCAACG | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |