Regulog DvMF_1479 - Desulfovibrionales

Properties
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Amino acid transport
Effector:
Phylum:	Proteobacteria/delta
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - GntR/Others
By pathway - Amino acid transport

Statistics of regulated genes
Genome	Genes	Operons
Desulfohalobium retbaense DSM 5692
Desulfomicrobium baculatum DSM 4028
Desulfovibrio desulfuricans G20
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
Desulfovibrio magneticus RS-1
Desulfovibrio piger ATCC 29098
Desulfovibrio salexigens DSM 2638
Desulfovibrio vulgaris Hildenborough
Desulfovibrio vulgaris str. Miyazaki F	6	1
Lawsonia intracellularis PHE/MN1-00

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes											Function

CRON 1.
DvMF_1483	Desulfohalobium retbaense DSM 5692	Desulfomicrobium baculatum DSM 4028 Gene: Dbac_1408: putative ABC transporter permease protein	Desulfovibrio desulfuricans G20	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774	Desulfovibrio magneticus RS-1 Gene: DMR_38950: putative ABC transporter permease protein	Desulfovibrio piger ATCC 29098	Desulfovibrio salexigens DSM 2638	Desulfovibrio vulgaris Hildenborough	* Desulfovibrio vulgaris str. Miyazaki F Site: position = -93 score = 6.44832 sequence = CTTTGTATACGGTATGCAACG Gene: DvMF_1483: putative ABC transporter permease protein	Lawsonia intracellularis PHE/MN1-00	putative ABC transporter permease protein
DvMF_1482	Desulfohalobium retbaense DSM 5692	Desulfomicrobium baculatum DSM 4028 Gene: Dbac_1407: Branched-chain amino acid transport system permease protein LivM (TC 3.A.1.4.1)	Desulfovibrio desulfuricans G20	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774	Desulfovibrio magneticus RS-1 Gene: DMR_38960: Branched-chain amino acid transport system permease protein LivM (TC 3.A.1.4.1)	Desulfovibrio piger ATCC 29098	Desulfovibrio salexigens DSM 2638	Desulfovibrio vulgaris Hildenborough	Desulfovibrio vulgaris str. Miyazaki F Gene: DvMF_1482: Branched-chain amino acid transport system permease protein LivM (TC 3.A.1.4.1)	Lawsonia intracellularis PHE/MN1-00	Branched-chain amino acid transport system permease protein LivM (TC 3.A.1.4.1)
DvMF_1481	Desulfohalobium retbaense DSM 5692	Desulfomicrobium baculatum DSM 4028 Gene: Dbac_1406: Branched-chain amino acid transport ATP-binding protein LivG (TC 3.A.1.4.1)	Desulfovibrio desulfuricans G20	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774	Desulfovibrio magneticus RS-1	Desulfovibrio piger ATCC 29098	Desulfovibrio salexigens DSM 2638	Desulfovibrio vulgaris Hildenborough	Desulfovibrio vulgaris str. Miyazaki F Gene: DvMF_1481: Branched-chain amino acid transport ATP-binding protein LivG (TC 3.A.1.4.1)	Lawsonia intracellularis PHE/MN1-00	Branched-chain amino acid transport ATP-binding protein LivG (TC 3.A.1.4.1)
DvMF_1480	Desulfohalobium retbaense DSM 5692	Desulfomicrobium baculatum DSM 4028	Desulfovibrio desulfuricans G20	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774	Desulfovibrio magneticus RS-1	Desulfovibrio piger ATCC 29098	Desulfovibrio salexigens DSM 2638	Desulfovibrio vulgaris Hildenborough	Desulfovibrio vulgaris str. Miyazaki F Gene: DvMF_1480: Branched-chain amino acid transport ATP-binding protein LivF (TC 3.A.1.4.1)	Lawsonia intracellularis PHE/MN1-00	Branched-chain amino acid transport ATP-binding protein LivF (TC 3.A.1.4.1)
DvMF_1479	Desulfohalobium retbaense DSM 5692	Desulfomicrobium baculatum DSM 4028	Desulfovibrio desulfuricans G20	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774	Desulfovibrio magneticus RS-1	Desulfovibrio piger ATCC 29098	Desulfovibrio salexigens DSM 2638	Desulfovibrio vulgaris Hildenborough	Desulfovibrio vulgaris str. Miyazaki F Gene: DvMF_1479: Transcriptional regulator, GntR family	Lawsonia intracellularis PHE/MN1-00	Transcriptional regulator, GntR family
DvMF_1478	Desulfohalobium retbaense DSM 5692	Desulfomicrobium baculatum DSM 4028 Gene: Dbac_1404: putative ABC transporter substrate binding protein precursor	Desulfovibrio desulfuricans G20	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774	Desulfovibrio magneticus RS-1 Gene: DMR_38970: putative ABC transporter substrate binding protein precursor	Desulfovibrio piger ATCC 29098	Desulfovibrio salexigens DSM 2638	Desulfovibrio vulgaris Hildenborough	Desulfovibrio vulgaris str. Miyazaki F Gene: DvMF_1478: putative ABC transporter substrate binding protein precursor	Lawsonia intracellularis PHE/MN1-00	putative ABC transporter substrate binding protein precursor

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog DvMF_1479 - Desulfovibrionales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --