Regulog DvMF_1479 - Desulfovibrionales
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Amino acid transport |
| Effector: | |
| Phylum: | Proteobacteria/delta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Desulfovibrionales
- By TF family - GntR/Others
- By pathway - Amino acid transport
| Genome | Genes | Operons |
|---|---|---|
| Desulfohalobium retbaense DSM 5692 | ||
| Desulfomicrobium baculatum DSM 4028 | ||
| Desulfovibrio desulfuricans G20 | ||
| Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 | ||
| Desulfovibrio magneticus RS-1 | ||
| Desulfovibrio piger ATCC 29098 | ||
| Desulfovibrio salexigens DSM 2638 | ||
| Desulfovibrio vulgaris Hildenborough | ||
| Desulfovibrio vulgaris str. Miyazaki F | 6 | 1 |
| Lawsonia intracellularis PHE/MN1-00 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| DvMF_1483 |
|
Gene: Dbac_1408: putative ABC transporter permease protein |
|
|
Gene: DMR_38950: putative ABC transporter permease protein |
|
|
|
*
Desulfovibrio vulgaris str. Miyazaki F Site: position = -93 score = 6.44832 sequence = CTTTGTATACGGTATGCAACG Gene: DvMF_1483: putative ABC transporter permease protein |
|
putative ABC transporter permease protein |
| DvMF_1482 |
|
Gene: Dbac_1407: Branched-chain amino acid transport system permease protein LivM (TC 3.A.1.4.1) |
|
|
Gene: DMR_38960: Branched-chain amino acid transport system permease protein LivM (TC 3.A.1.4.1) |
|
|
|
Gene: DvMF_1482: Branched-chain amino acid transport system permease protein LivM (TC 3.A.1.4.1) |
|
Branched-chain amino acid transport system permease protein LivM (TC 3.A.1.4.1) |
| DvMF_1481 |
|
Gene: Dbac_1406: Branched-chain amino acid transport ATP-binding protein LivG (TC 3.A.1.4.1) |
|
|
|
|
|
|
Gene: DvMF_1481: Branched-chain amino acid transport ATP-binding protein LivG (TC 3.A.1.4.1) |
|
Branched-chain amino acid transport ATP-binding protein LivG (TC 3.A.1.4.1) |
| DvMF_1480 |
|
|
|
|
|
|
|
|
Gene: DvMF_1480: Branched-chain amino acid transport ATP-binding protein LivF (TC 3.A.1.4.1) |
|
Branched-chain amino acid transport ATP-binding protein LivF (TC 3.A.1.4.1) |
| DvMF_1479 |
|
|
|
|
|
|
|
|
Gene: DvMF_1479: Transcriptional regulator, GntR family |
|
Transcriptional regulator, GntR family |
| DvMF_1478 |
|
Gene: Dbac_1404: putative ABC transporter substrate binding protein precursor |
|
|
Gene: DMR_38970: putative ABC transporter substrate binding protein precursor |
|
|
|
Gene: DvMF_1478: putative ABC transporter substrate binding protein precursor |
|
putative ABC transporter substrate binding protein precursor |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |