Regulon of DVU0057 in Desulfovibrio vulgaris str. Miyazaki F
Regulator type: | Transcription factor |
TF locus tag: | DvMF_2165 |
Regulator family: | TetR |
Regulation mode: | |
Biological process: | |
Effector: | |
Regulog: | DVU0057 - Desulfovibrionales |
Statistics of regulated genes: | |
- Genes | 5 |
- Operons | 1 |
Visualization: | |
![]() |
Allows to visualize regulon content in the context of metabolic pathways |

Member of regulog collections
- By taxonomy - Desulfovibrionales
- By TF family - TetR
Locus Tag | Name | Function | |
---|---|---|---|
Position: -70
Score: 7 Sequence: GGTTCAAACAATGATTGAATT
Locus tag: DvMF_2165
Name: null Funciton: Transcriptional regulator, TetR family
Locus tag: DvMF_2164
Name: acrA Funciton: efflux transporter, RND family, MFP subunit
Locus tag: DvMF_2163
Name: acrB Funciton: RND efflux system, inner membrane transporter CmeB
Locus tag: DvMF_2162
Name: oprM Funciton: RND efflux system, outer membrane lipoprotein, NodT family
Locus tag: DvMF_2161
Name: null Funciton: Transcriptional regulator, MarR family |
|||
Transcriptional regulator, TetR family
|
|||
acrA
|
efflux transporter, RND family, MFP subunit
|
||
acrB
|
RND efflux system, inner membrane transporter CmeB
|
||
oprM
|
RND efflux system, outer membrane lipoprotein, NodT family
|
||
Transcriptional regulator, MarR family
|
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |