Profile of regulator DVU0057 in Desulfovibrionales
| Regulator family: | TetR |
| Regulation mode: | |
| Biological process: | |
| Effector: | |
| Regulog: | DVU0057 - Desulfovibrionales |
Member of regulog collections
- By taxonomy - Desulfovibrionales
- By TF family - TetR
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Desulfovibrio salexigens DSM 2638 | |||||
| Desal_0950 | null | -37 | 6.7 | GCTTCAAACAGTGTTTTAATT | |
| Desulfovibrio vulgaris Hildenborough | |||||
| DVU0057 | null | -31 | 6.7 | GTTTCAAACAAGGGTTGAAAC | |
| Desulfovibrio vulgaris str. Miyazaki F | |||||
| DvMF_2165 | null | -70 | 7 | GGTTCAAACAATGATTGAATT | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |