Regulon of DVU0057 in Desulfovibrio salexigens DSM 2638

Properties
Regulator type:	Transcription factor
TF locus tag:	Desal_0950
Regulator family:	TetR
Regulation mode:
Biological process:
Effector:
Regulog:	DVU0057 - Desulfovibrionales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - TetR

Regulated operons
	Locus Tag	Name	Function
Position: -37 Score: 6.7 Sequence: GCTTCAAACAGTGTTTTAATT Locus tag: Desal_0950 Name: null Funciton: transcriptional regulator, TetR family Locus tag: Desal_0949 Name: null Funciton: efflux transporter, RND family, MFP subunit Locus tag: Desal_0948 Name: null Funciton: acriflavin resistance protein
	Desal_0950		transcriptional regulator, TetR family
	Desal_0949		efflux transporter, RND family, MFP subunit
	Desal_0948		acriflavin resistance protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD