Regulon of PhnF in Methylibium petroleiphilum PM1

Properties
Regulator type:	Transcription factor
TF locus tag:	Mpe_B0420, Mpe_B0456
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Phosphonate utilization
Effector:
Regulog:	PhnF - Comamonadaceae
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By trascription factor - PhnF
By taxonomy - Comamonadaceae
By TF family - GntR/Others
By pathway - Phosphonate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -28 Score: 4.4 Sequence: CCCAGATATCTAGACATCTGGA Locus tag: Mpe_B0456 Name: phnF Funciton: phophonate C-P lyase system transcriptional regulator PhnF, GntR family Locus tag: Mpe_B0457 Name: phnD Funciton: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1) Locus tag: Mpe_B0458 Name: phnC Funciton: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1)
	Mpe_B0456	phnF	phophonate C-P lyase system transcriptional regulator PhnF, GntR family
	Mpe_B0457	phnD	Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1)
	Mpe_B0458	phnC	Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1)
Position: -28 Score: 4.4 Sequence: CCCAGATATCTAGACATCTGGA Locus tag: Mpe_B0420 Name: phnF Funciton: phophonate C-P lyase system transcriptional regulator PhnF, GntR family Locus tag: Mpe_B0421 Name: phnD Funciton: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1) Locus tag: Mpe_B0422 Name: phnC Funciton: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1)
	Mpe_B0420	phnF	phophonate C-P lyase system transcriptional regulator PhnF, GntR family
	Mpe_B0421	phnD	Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1)
	Mpe_B0422	phnC	Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD