Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Regulog PhnF - Comamonadaceae

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Phosphonate utilization
Effector:
Phylum: Proteobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Acidovorax avenae subsp. citrulli AAC00-1
Acidovorax sp. JS42
Comamonas testosteroni KF-1
Delftia acidovorans SPH-1
Polaromonas naphthalenivorans CJ2
Polaromonas sp. JS666
Rhodoferax ferrireducens DSM 15236
Variovorax paradoxus S110
Verminephrobacter eiseniae EF01-2
Methylibium petroleiphilum PM1 6 2
Leptothrix cholodnii SP-6
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
phnF
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_0146: phophonate C-P lyase system transcriptional regulator PhnF, GntR family
 
Variovorax paradoxus S110

Gene: Vapar_6099: phophonate C-P lyase system transcriptional regulator PhnF, GntR family
 
Verminephrobacter eiseniae EF01-2
*2
Methylibium petroleiphilum PM1

Site:
position = -28
score = 4.37072
sequence = CCCAGATATCTAGACATCTGGA

Gene: Mpe_B0420: phophonate C-P lyase system transcriptional regulator PhnF, GntR family

Site:
position = -28
score = 4.37072
sequence = CCCAGATATCTAGACATCTGGA

Gene: Mpe_B0456: phophonate C-P lyase system transcriptional regulator PhnF, GntR family
 
Leptothrix cholodnii SP-6
phophonate C-P lyase system transcriptional regulator PhnF, GntR family
phnD
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 2
Methylibium petroleiphilum PM1

Gene: Mpe_B0421: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1)

Gene: Mpe_B0457: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1)
 
Leptothrix cholodnii SP-6
Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1)
phnC
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 2
Methylibium petroleiphilum PM1

Gene: Mpe_B0458: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1)

Gene: Mpe_B0422: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1)
 
Leptothrix cholodnii SP-6
Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD
© 2009-2020 RegPrecise