Regulog PhnF - Comamonadaceae
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Phosphonate utilization |
| Effector: | |
| Phylum: | Proteobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - PhnF
- By taxonomy - Comamonadaceae
- By TF family - GntR/Others
- By pathway - Phosphonate utilization
| Genome | Genes | Operons |
|---|---|---|
| Acidovorax avenae subsp. citrulli AAC00-1 | ||
| Acidovorax sp. JS42 | ||
| Comamonas testosteroni KF-1 | ||
| Delftia acidovorans SPH-1 | ||
| Polaromonas naphthalenivorans CJ2 | ||
| Polaromonas sp. JS666 | ||
| Rhodoferax ferrireducens DSM 15236 | ||
| Variovorax paradoxus S110 | ||
| Verminephrobacter eiseniae EF01-2 | ||
| Methylibium petroleiphilum PM1 | 6 | 2 |
| Leptothrix cholodnii SP-6 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| phnF |
|
|
|
|
|
|
Gene: Rfer_0146: phophonate C-P lyase system transcriptional regulator PhnF, GntR family |
Gene: Vapar_6099: phophonate C-P lyase system transcriptional regulator PhnF, GntR family |
|
*2
Methylibium petroleiphilum PM1 Site: position = -28 score = 4.37072 sequence = CCCAGATATCTAGACATCTGGA Gene: Mpe_B0420: phophonate C-P lyase system transcriptional regulator PhnF, GntR family Site: position = -28 score = 4.37072 sequence = CCCAGATATCTAGACATCTGGA Gene: Mpe_B0456: phophonate C-P lyase system transcriptional regulator PhnF, GntR family |
|
phophonate C-P lyase system transcriptional regulator PhnF, GntR family |
| phnD |
|
|
|
|
|
|
|
|
|
2
Methylibium petroleiphilum PM1 Gene: Mpe_B0421: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1) Gene: Mpe_B0457: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1) |
|
Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1) |
| phnC |
|
|
|
|
|
|
|
|
|
2
Methylibium petroleiphilum PM1 Gene: Mpe_B0458: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1) Gene: Mpe_B0422: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1) |
|
Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |