Profile of regulator PhnF in Comamonadaceae
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Phosphonate utilization |
| Effector: | |
| Regulog: | PhnF - Comamonadaceae |
Member of regulog collections
- By trascription factor - PhnF
- By taxonomy - Comamonadaceae
- By TF family - GntR/Others
- By pathway - Phosphonate utilization
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Methylibium petroleiphilum PM1 | |||||
| Mpe_B0420 | phnF | -28 | 4.4 | CCCAGATATCTAGACATCTGGA | |
| Mpe_B0456 | phnF | -28 | 4.4 | CCCAGATATCTAGACATCTGGA | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |