Regulon of RutR in Caulobacter segnis ATCC 21756

Properties
Regulator type:	Transcription factor
TF locus tag:	Cseg_2077
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Pyrimidine utilization
Effector:	Uracil
Regulog:	RutR - Caulobacterales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By trascription factor - RutR
By taxonomy - Caulobacterales
By TF family - TetR
By effector - Uracil
By pathway - Pyrimidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -31 Score: 6.1 Sequence: GTTTGACCAAATGGTCCAAA Locus tag: Cseg_2077 Name: rutR Funciton: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
	Cseg_2077	rutR	Transcriptional regulator RutR of pyrimidine catabolism, TetR family
Position: -98 Score: 5.9 Sequence: TTTGGACCATTTGGTCAAAC Locus tag: Cseg_2078 Name: rutB Funciton: Peroxyureidoacrylate / ureidoacrylate amido hydrolase Locus tag: Cseg_2079 Name: rutC Funciton: Aminoacrylate peracid reductase Locus tag: Cseg_2080 Name: rutD Funciton: Aminoacrylate hydrolase Locus tag: Cseg_2081 Name: rutA Funciton: Pyrimidine oxygenase
	Cseg_2078	rutB	Peroxyureidoacrylate / ureidoacrylate amido hydrolase
	Cseg_2079	rutC	Aminoacrylate peracid reductase
	Cseg_2080	rutD	Aminoacrylate hydrolase
	Cseg_2081	rutA	Pyrimidine oxygenase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD