Regulog RutR - Caulobacterales
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Pyrimidine utilization |
| Effector: | Uracil |
| Phylum: | Proteobacteria/alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - RutR
- By taxonomy - Caulobacterales
- By TF family - TetR
- By effector - Uracil
- By pathway - Pyrimidine utilization
| Genome | Genes | Operons |
|---|---|---|
| Caulobacter crescentus CB15 | 5 | 2 |
| Caulobacter segnis ATCC 21756 | 5 | 2 |
| Caulobacter sp. K31 | ||
| Phenylobacterium zucineum HLK1 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| rutB |
*
Caulobacter crescentus CB15 Site: position = -137 score = 5.48597 sequence = TCTGGACCATTTGGTCAAAC Gene: CC2795: Peroxyureidoacrylate / ureidoacrylate amido hydrolase |
*
Caulobacter segnis ATCC 21756 Site: position = -98 score = 5.86934 sequence = TTTGGACCATTTGGTCAAAC Gene: Cseg_2078: Peroxyureidoacrylate / ureidoacrylate amido hydrolase |
Gene: Caul_3979: Peroxyureidoacrylate / ureidoacrylate amido hydrolase |
|
Peroxyureidoacrylate / ureidoacrylate amido hydrolase |
| rutC |
Gene: CC2796: Aminoacrylate peracid reductase |
Gene: Cseg_2079: Aminoacrylate peracid reductase |
Gene: Caul_3980: Aminoacrylate peracid reductase |
|
Aminoacrylate peracid reductase |
| rutD |
Gene: CC2797: Aminoacrylate hydrolase |
Gene: Cseg_2080: Aminoacrylate hydrolase |
Gene: Caul_3981: Aminoacrylate hydrolase |
|
Aminoacrylate hydrolase |
| rutA |
Gene: CC2798: Pyrimidine oxygenase |
Gene: Cseg_2081: Pyrimidine oxygenase |
Gene: Caul_3982: Pyrimidine oxygenase |
|
Pyrimidine oxygenase |
| CRON 2. | |||||
| rutR |
*
Caulobacter crescentus CB15 Site: position = -31 score = 5.74706 sequence = GTTTGACCAAATGGTCCAGA Gene: CC2794: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
*
Caulobacter segnis ATCC 21756 Site: position = -31 score = 6.14457 sequence = GTTTGACCAAATGGTCCAAA Gene: Cseg_2077: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
|
|
Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |