Regulon of RutR in Roseobacter sp. MED193

Properties
Regulator type:	Transcription factor
TF locus tag:	MED193_05524
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Pyrimidine utilization
Effector:	Uracil
Regulog:	RutR - Rhodobacterales
Statistics of regulated genes:
- Genes	24
- Operons	8
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 62 sites [see more]

Member of regulog collections

By trascription factor - RutR
By taxonomy - Rhodobacterales
By TF family - TetR
By effector - Uracil
By pathway - Pyrimidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -105 Score: 5.5 Sequence: ATTTGTCCAAAAGGTCAAAT Locus tag: MED193_12973 Name: deoC Funciton: Deoxyribose-phosphate aldolase (EC 4.1.2.4) Locus tag: MED193_12978 Name: ald Funciton: Aldehyde dehydrogenase (EC 1.2.1.3)
	MED193_12973	deoC	Deoxyribose-phosphate aldolase (EC 4.1.2.4)
	MED193_12978	ald	Aldehyde dehydrogenase (EC 1.2.1.3)
Position: -155 Score: 6 Sequence: ATTTGACCAACTGGTCAAAC Locus tag: MED193_05524 Name: rutR Funciton: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
	MED193_05524	rutR	Transcriptional regulator RutR of pyrimidine catabolism, TetR family
Position: 74 Score: 5 Sequence: TTTTTACCCTTTGGACAAGA Locus tag: MED193_17244 Name: pytM Funciton: Predicted pyrimidine ABC transporter, substrate-binding protein Locus tag: MED193_17239 Name: pytN Funciton: Predicted pyrimidine ABC transporter, ATP-binding protein Locus tag: MED193_17234 Name: pytO Funciton: Predicted pyrimidine ABC transporter, permease protein 1 Locus tag: MED193_17229 Name: pytQ Funciton: Predicted pyrimidine ABC transporter, permease protein 2 Locus tag: MED193_17224 Name: codA Funciton: Cytosine deaminase (EC 3.5.4.1)
	MED193_17244	pytM	Predicted pyrimidine ABC transporter, substrate-binding protein
	MED193_17239	pytN	Predicted pyrimidine ABC transporter, ATP-binding protein
	MED193_17234	pytO	Predicted pyrimidine ABC transporter, permease protein 1
	MED193_17229	pytQ	Predicted pyrimidine ABC transporter, permease protein 2
	MED193_17224	codA	Cytosine deaminase (EC 3.5.4.1)
Position: -97 Score: 5.4 Sequence: CTTTGACCATCAGATCAAAA Locus tag: MED193_06029 Name: upp Funciton: Uracil phosphoribosyltransferase (EC 2.4.2.9)
	MED193_06029	upp	Uracil phosphoribosyltransferase (EC 2.4.2.9)
Position: -154 Score: 4.7 Sequence: TTCGCACCAAACGGTCAAAA Locus tag: MED193_10378 Name: pntD Funciton: Predicted nucleoside ABC transporter, substrate-binding protein Locus tag: MED193_10383 Name: OG2516_07987 Funciton: Conserved hypothetical protein Locus tag: MED193_10388 Name: pntA Funciton: Predicted nucleoside ABC transporter, ATP-binding protein Locus tag: MED193_10393 Name: pntB Funciton: Predicted nucleoside ABC transporter, permease protein 1 Locus tag: MED193_10398 Name: pntC Funciton: Predicted nucleoside ABC transporter, permease protein 2
	MED193_10378	pntD	Predicted nucleoside ABC transporter, substrate-binding protein
	MED193_10383	OG2516_07987	Conserved hypothetical protein
	MED193_10388	pntA	Predicted nucleoside ABC transporter, ATP-binding protein
	MED193_10393	pntB	Predicted nucleoside ABC transporter, permease protein 1
	MED193_10398	pntC	Predicted nucleoside ABC transporter, permease protein 2
Position: -74 Score: 6.1 Sequence: ATTTTACCAGTTGATAAAAA Locus tag: MED193_05534 Name: pydX Funciton: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism Locus tag: MED193_05529 Name: pydA Funciton: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2)
	MED193_05534	pydX	Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
	MED193_05529	pydA	Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2)
Position: -119 Score: 6.1 Sequence: GTTTGACCAGTTGGTCAAAT Locus tag: MED193_05519 Name: pydC Funciton: Beta-ureidopropionase (EC 3.5.1.6) Locus tag: MED193_05514 Name: pydB Funciton: phenylhydantoinase Locus tag: MED193_05509 Name: pytA Funciton: Pyrimidine ABC transporter, ATP-binding protein Locus tag: MED193_05504 Name: MED193_05504 Funciton: Hypothetical protein Locus tag: MED193_05499 Name: pytB Funciton: Pyrimidine ABC transporter, permease protein 1 Locus tag: MED193_05494 Name: MED193_05494 Funciton: Hypothetical protein Locus tag: MED193_05489 Name: pytC Funciton: Pyrimidine ABC transporter, permease protein 2
	MED193_05519	pydC	Beta-ureidopropionase (EC 3.5.1.6)
	MED193_05514	pydB	phenylhydantoinase
	MED193_05509	pytA	Pyrimidine ABC transporter, ATP-binding protein
	MED193_05504	MED193_05504	Hypothetical protein
	MED193_05499	pytB	Pyrimidine ABC transporter, permease protein 1
	MED193_05494	MED193_05494	Hypothetical protein
	MED193_05489	pytC	Pyrimidine ABC transporter, permease protein 2
Position: -60 Score: 5.1 Sequence: ATTTGATCGAAGGGTCAAAT Locus tag: MED193_05484 Name: pytD Funciton: Pyrimidine ABC transporter, substrate-binding protein
	MED193_05484	pytD	Pyrimidine ABC transporter, substrate-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of RutR in Roseobacter sp. MED193

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --