Regulon of RutR in Rhodobacterales bacterium HTCC2654

Properties
Regulator type:	Transcription factor
TF locus tag:	RB2654_07801
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Pyrimidine utilization
Effector:	Uracil
Regulog:	RutR - Rhodobacterales
Statistics of regulated genes:
- Genes	14
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 62 sites [see more]

Member of regulog collections

By trascription factor - RutR
By taxonomy - Rhodobacterales
By TF family - TetR
By effector - Uracil
By pathway - Pyrimidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -186 Score: 4.8 Sequence: TTTTGAACGTCGGGTCAAAT Locus tag: RB2654_20923 Name: pntD Funciton: Predicted nucleoside ABC transporter, substrate-binding protein Locus tag: RB2654_20928 Name: pntA Funciton: Predicted nucleoside ABC transporter, ATP-binding protein Locus tag: RB2654_20933 Name: pntB Funciton: Predicted nucleoside ABC transporter, permease protein 1 Locus tag: RB2654_20938 Name: pntC Funciton: Predicted nucleoside ABC transporter, permease protein 2
	RB2654_20923	pntD	Predicted nucleoside ABC transporter, substrate-binding protein
	RB2654_20928	pntA	Predicted nucleoside ABC transporter, ATP-binding protein
	RB2654_20933	pntB	Predicted nucleoside ABC transporter, permease protein 1
	RB2654_20938	pntC	Predicted nucleoside ABC transporter, permease protein 2
Position: -26 Score: 5.4 Sequence: ATTTGACCAAAAGGAAAAAT Locus tag: RB2654_10383 Name: deoC Funciton: Deoxyribose-phosphate aldolase (EC 4.1.2.4) Locus tag: RB2654_10378 Name: ald Funciton: Aldehyde dehydrogenase (EC 1.2.1.3)
	RB2654_10383	deoC	Deoxyribose-phosphate aldolase (EC 4.1.2.4)
	RB2654_10378	ald	Aldehyde dehydrogenase (EC 1.2.1.3)
Position: -29 Score: 5 Sequence: ACTGGACCATACGGTCAAAG Locus tag: RB2654_20823 Name: cdd Funciton: Cytidine deaminase (EC 3.5.4.5) Locus tag: RB2654_20828 Name: deoB Funciton: Phosphopentomutase (EC 5.4.2.7) Locus tag: RB2654_20833 Name: add Funciton: Adenosine deaminase (EC 3.5.4.4) Locus tag: RB2654_20838 Name: upp Funciton: Uracil phosphoribosyltransferase (EC 2.4.2.9)
	RB2654_20823	cdd	Cytidine deaminase (EC 3.5.4.5)
	RB2654_20828	deoB	Phosphopentomutase (EC 5.4.2.7)
	RB2654_20833	add	Adenosine deaminase (EC 3.5.4.4)
	RB2654_20838	upp	Uracil phosphoribosyltransferase (EC 2.4.2.9)
Position: -61 Score: 4.9 Sequence: CGTTGATCATCTGGTCAAAT Locus tag: RB2654_07801 Name: rutR Funciton: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
	RB2654_07801	rutR	Transcriptional regulator RutR of pyrimidine catabolism, TetR family
Position: -337 Score: 6.1 Sequence: TTTTTACCAATTGATAAAAA Locus tag: RB2654_14990 Name: pydX Funciton: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism Locus tag: RB2654_14980 Name: pydX Funciton: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
	RB2654_14990	pydX	Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
	RB2654_14980	pydX	Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
Position: -233 Score: 5.8 Sequence: ATTTAACCGAATGGTAAAAA Locus tag: RB2654_14955 Name: pydC Funciton: Beta-ureidopropionase (EC 3.5.1.6)
	RB2654_14955	pydC	Beta-ureidopropionase (EC 3.5.1.6)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of RutR in Rhodobacterales bacterium HTCC2654

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --