Regulon of RutR in Jannaschia sp. CCS1

Properties
Regulator type:	Transcription factor
TF locus tag:	Jann_2710
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Pyrimidine utilization
Effector:	Uracil
Regulog:	RutR - Rhodobacterales
Statistics of regulated genes:
- Genes	24
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 62 sites [see more]

Member of regulog collections

By trascription factor - RutR
By taxonomy - Rhodobacterales
By TF family - TetR
By effector - Uracil
By pathway - Pyrimidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -65 Score: 5.6 Sequence: TTTTGACCGTTTGGTCAACC Locus tag: Jann_0789 Name: deoC Funciton: Deoxyribose-phosphate aldolase (EC 4.1.2.4) Locus tag: Jann_0788 Name: Jann_0788 Funciton: Hypothetical protein Locus tag: Jann_0787 Name: Jann_0787 Funciton: Hypothetical protein Locus tag: Jann_0786 Name: ald Funciton: Aldehyde dehydrogenase (EC 1.2.1.3)
	Jann_0789	deoC	Deoxyribose-phosphate aldolase (EC 4.1.2.4)
	Jann_0788	Jann_0788	Hypothetical protein
	Jann_0787	Jann_0787	Hypothetical protein
	Jann_0786	ald	Aldehyde dehydrogenase (EC 1.2.1.3)
Position: -177 Score: 5.4 Sequence: TTTTGACCAAACGGTCAAGG Locus tag: Jann_2710 Name: rutR Funciton: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
	Jann_2710	rutR	Transcriptional regulator RutR of pyrimidine catabolism, TetR family
Position: -36 Score: 5.5 Sequence: ATTTTACCATATGGTAAGGA Locus tag: Jann_1306 Name: codA Funciton: Cytosine deaminase (EC 3.5.4.1) Locus tag: Jann_1305 Name: pytM Funciton: Predicted pyrimidine ABC transporter, substrate-binding protein Locus tag: Jann_1304 Name: amiC Funciton: Predicted amidase Locus tag: Jann_1303 Name: pytN Funciton: Predicted pyrimidine ABC transporter, ATP-binding protein Locus tag: Jann_1302 Name: pytO Funciton: Predicted pyrimidine ABC transporter, permease protein 1 Locus tag: Jann_1301 Name: pytQ Funciton: Predicted pyrimidine ABC transporter, permease protein 2
	Jann_1306	codA	Cytosine deaminase (EC 3.5.4.1)
	Jann_1305	pytM	Predicted pyrimidine ABC transporter, substrate-binding protein
	Jann_1304	amiC	Predicted amidase
	Jann_1303	pytN	Predicted pyrimidine ABC transporter, ATP-binding protein
	Jann_1302	pytO	Predicted pyrimidine ABC transporter, permease protein 1
	Jann_1301	pytQ	Predicted pyrimidine ABC transporter, permease protein 2
Position: -76 Score: 5.8 Sequence: ATTTTACCATTTGATAAATT Locus tag: Jann_2713 Name: pydX Funciton: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism Locus tag: Jann_2712 Name: pydA Funciton: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2)
	Jann_2713	pydX	Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
	Jann_2712	pydA	Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2)
Position: -57 Score: 5.7 Sequence: CCTTGACCGTTTGGTCAAAA Locus tag: Jann_2709 Name: praX Funciton: Omega-amino acid--pyruvate aminotransferase (EC 2.6.1.18) Locus tag: Jann_2708 Name: Jann_2708 Funciton: Hypothetical protein Locus tag: Jann_2707 Name: pydC Funciton: Beta-ureidopropionase (EC 3.5.1.6) Locus tag: Jann_2706 Name: Jann_2706 Funciton: hypothetical protein Locus tag: Jann_2705 Name: pydB Funciton: phenylhydantoinase Locus tag: Jann_2704 Name: Jann_2704 Funciton: Hypothetical protein Locus tag: Jann_2703 Name: pytA Funciton: Pyrimidine ABC transporter, ATP-binding protein Locus tag: Jann_2702 Name: Jann_2702 Funciton: Predicted N-acetyltransferase Locus tag: Jann_2701 Name: pytB Funciton: Pyrimidine ABC transporter, permease protein 1 Locus tag: Jann_2700 Name: pytC Funciton: Pyrimidine ABC transporter, permease protein 2 Locus tag: Jann_2699 Name: pytD Funciton: Pyrimidine ABC transporter, substrate-binding protein
	Jann_2709	praX	Omega-amino acid--pyruvate aminotransferase (EC 2.6.1.18)
	Jann_2708	Jann_2708	Hypothetical protein
	Jann_2707	pydC	Beta-ureidopropionase (EC 3.5.1.6)
	Jann_2706	Jann_2706	hypothetical protein
	Jann_2705	pydB	phenylhydantoinase
	Jann_2704	Jann_2704	Hypothetical protein
	Jann_2703	pytA	Pyrimidine ABC transporter, ATP-binding protein
	Jann_2702	Jann_2702	Predicted N-acetyltransferase
	Jann_2701	pytB	Pyrimidine ABC transporter, permease protein 1
	Jann_2700	pytC	Pyrimidine ABC transporter, permease protein 2
	Jann_2699	pytD	Pyrimidine ABC transporter, substrate-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of RutR in Jannaschia sp. CCS1

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --