Regulon of RutR in Paracoccus denitrificans PD1222

Properties
Regulator type:	Transcription factor
TF locus tag:	Pden_1121
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Pyrimidine utilization
Effector:	Uracil
Regulog:	RutR - Rhodobacterales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 62 sites [see more]

Member of regulog collections

By trascription factor - RutR
By taxonomy - Rhodobacterales
By TF family - TetR
By effector - Uracil
By pathway - Pyrimidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -225 Score: 5.1 Sequence: TATTGACTGGTTGATAAAAT Locus tag: Pden_1113 Name: pydC Funciton: Beta-ureidopropionase (EC 3.5.1.6) Locus tag: Pden_1112 Name: pydB Funciton: phenylhydantoinase Locus tag: Pden_1111 Name: pydP Funciton: Pyrimidine permease in reductive pathway
	Pden_1113	pydC	Beta-ureidopropionase (EC 3.5.1.6)
	Pden_1112	pydB	phenylhydantoinase
	Pden_1111	pydP	Pyrimidine permease in reductive pathway

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD