Regulon of RutR in Alteromonas macleodii 'Deep ecotype'

Properties
Regulator type:	Transcription factor
TF locus tag:	MADE_02513
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Pyrimidine utilization
Effector:	Uracil
Regulog:	RutR - Alteromonadales
Statistics of regulated genes:
- Genes	13
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By trascription factor - RutR
By taxonomy - Alteromonadales
By TF family - TetR
By effector - Uracil
By pathway - Pyrimidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -71 Score: 5.7 Sequence: AGTTGACTAATTGGTCAGTT Locus tag: MADE_02510 Name: pbuT Funciton: Xanthine/uracil permease
	MADE_02510	pbuT	Xanthine/uracil permease
Position: -207 Score: 5.7 Sequence: ACTTGACCATGTGGTCAGGT Locus tag: MADE_00733 Name: omp1 Funciton: putative TonB-dependent outer membrane transporter
	MADE_00733	omp1	putative TonB-dependent outer membrane transporter
Position: -124 Score: 5.2 Sequence: AGTTGACCAACTGGTTAAGT Locus tag: MADE_02502 Name: omp2 Funciton: putative TonB-dependent outer membrane transporter
	MADE_02502	omp2	putative TonB-dependent outer membrane transporter
Position: -83 Score: 5.8 Sequence: AATTGACCATTTGGTCTACT Locus tag: MADE_02515 Name: xdhA Funciton: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4) Locus tag: MADE_02516 Name: xdhB Funciton: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4) Locus tag: MADE_02517 Name: xdhC Funciton: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase) Locus tag: MADE_02518 Name: pucL Funciton: Uricase (EC 1.7.3.3) Locus tag: MADE_02519 Name: pucM Funciton: Hydroxyisourate hydrolase (EC 3.5.2.17) Locus tag: MADE_02520 Name: guaD Funciton: Guanine deaminase (EC 3.5.4.3) Locus tag: MADE_02521 Name: COG3748 Funciton: hypothetical protein, COG3748
	MADE_02515	xdhA	Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
	MADE_02516	xdhB	Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
	MADE_02517	xdhC	XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
	MADE_02518	pucL	Uricase (EC 1.7.3.3)
	MADE_02519	pucM	Hydroxyisourate hydrolase (EC 3.5.2.17)
	MADE_02520	guaD	Guanine deaminase (EC 3.5.4.3)
	MADE_02521	COG3748	hypothetical protein, COG3748
Position: -353 Score: 5.5 Sequence: AACAGACCAGTTGGTCAACA Locus tag: MADE_02501 Name: pbuT2 Funciton: Xanthine/uracil permease
	MADE_02501	pbuT2	Xanthine/uracil permease
Position: -183 Score: 4.9 Sequence: AACTGACCACTTGGAGAACT Locus tag: MADE_00730 Name: udk Funciton: Uridine kinase (EC 2.7.1.48) Locus tag: MADE_00729 Name: nupX Funciton: Nucleoside permease
	MADE_00730	udk	Uridine kinase (EC 2.7.1.48)
	MADE_00729	nupX	Nucleoside permease

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD