Regulon of RutR in Pseudoalteromonas atlantica T6c

Properties
Regulator type:	Transcription factor
TF locus tag:	Patl_2423
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Pyrimidine utilization
Effector:	Uracil
Regulog:	RutR - Alteromonadales
Statistics of regulated genes:
- Genes	16
- Operons	7
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By trascription factor - RutR
By taxonomy - Alteromonadales
By TF family - TetR
By effector - Uracil
By pathway - Pyrimidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -180 Score: 5.3 Sequence: ACTTGACCATATGGTCCACA Locus tag: Patl_0533 Name: udk Funciton: Uridine kinase (EC 2.7.1.48) Locus tag: Patl_0532 Name: nupX Funciton: Nucleoside permease
	Patl_0533	udk	Uridine kinase (EC 2.7.1.48)
	Patl_0532	nupX	Nucleoside permease
Position: -98 Score: 5.2 Sequence: GCTAGACTAAATGGTCAGGT Locus tag: Patl_2421 Name: pbuT Funciton: Xanthine/uracil permease
	Patl_2421	pbuT	Xanthine/uracil permease
Position: -127 Score: 4.3 Sequence: TTTTGACCAGTTAGTCAAAT Locus tag: Patl_0536 Name: omp1 Funciton: putative TonB-dependent outer membrane transporter
	Patl_0536	omp1	putative TonB-dependent outer membrane transporter
Position: -112 Score: 5.7 Sequence: ACCTGACCATTTGGACAAGT Locus tag: Patl_2225 Name: omp2 Funciton: putative TonB-dependent outer membrane transporter
	Patl_2225	omp2	putative TonB-dependent outer membrane transporter
Position: -242 Score: 5.9 Sequence: ACCAGACCAGTTGGTCAGGT Locus tag: Patl_2423 Name: rutR Funciton: Transcriptional regulator RutR of pyrimidine catabolism, TetR family Locus tag: Patl_2422 Name: COG0726 Funciton: putative polysaccharide deacetylase family protein
	Patl_2423	rutR	Transcriptional regulator RutR of pyrimidine catabolism, TetR family
	Patl_2422	COG0726	putative polysaccharide deacetylase family protein
Position: -91 Score: 5.7 Sequence: ACCTGACCAACTGGTCTGGT Locus tag: Patl_2424 Name: xdhA Funciton: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4) Locus tag: Patl_2425 Name: xdhB Funciton: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4) Locus tag: Patl_2426 Name: xdhC Funciton: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase) Locus tag: Patl_2427 Name: pucL Funciton: Uricase (EC 1.7.3.3) Locus tag: Patl_2428 Name: pucM Funciton: Hydroxyisourate hydrolase (EC 3.5.2.17) Locus tag: Patl_2429 Name: guaD Funciton: Guanine deaminase (EC 3.5.4.3) Locus tag: Patl_2430 Name: COG3748 Funciton: hypothetical protein, COG3748
	Patl_2424	xdhA	Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
	Patl_2425	xdhB	Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
	Patl_2426	xdhC	XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
	Patl_2427	pucL	Uricase (EC 1.7.3.3)
	Patl_2428	pucM	Hydroxyisourate hydrolase (EC 3.5.2.17)
	Patl_2429	guaD	Guanine deaminase (EC 3.5.4.3)
	Patl_2430	COG3748	hypothetical protein, COG3748
Position: -27 Score: 5.5 Sequence: GACTGACCATTTGGTCAAAT Locus tag: Patl_2222 Name: add2 Funciton: Adenosine deaminase (EC 3.5.4.4) Locus tag: Patl_2223 Name: pbuT2 Funciton: Xanthine/uracil permease
	Patl_2222	add2	Adenosine deaminase (EC 3.5.4.4)
	Patl_2223	pbuT2	Xanthine/uracil permease

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of RutR in Pseudoalteromonas atlantica T6c

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --