Regulon of RutR in Photobacterium profundum SS9

Properties
Regulator type:	Transcription factor
TF locus tag:	PBPRA2268
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Pyrimidine utilization
Effector:	Uracil
Regulog:	RutR - Vibrionales
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By trascription factor - RutR
By taxonomy - Vibrionales
By TF family - TetR
By effector - Uracil
By pathway - Pyrimidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -74 Score: 5.6 Sequence: AGTTGACTAAAAAGTCAGCT Position: -47 Score: 5.9 Sequence: TATTGACTCAAAGGTCAGAA Locus tag: PBPRA2243 Name: xdhA Funciton: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4) Locus tag: PBPRA2244 Name: xdhB Funciton: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4) Locus tag: PBPRA2245 Name: xdhC Funciton: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase) Locus tag: PBPRA2246 Name: guaD Funciton: Guanine deaminase (EC 3.5.4.3)
	PBPRA2243	xdhA	Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
	PBPRA2244	xdhB	Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
	PBPRA2245	xdhC	XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
	PBPRA2246	guaD	Guanine deaminase (EC 3.5.4.3)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD