Regulog RutR - Vibrionales
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Pyrimidine utilization |
| Effector: | Uracil |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - RutR
- By taxonomy - Vibrionales
- By TF family - TetR
- By effector - Uracil
- By pathway - Pyrimidine utilization
| Genome | Genes | Operons |
|---|---|---|
| Vibrio cholerae O1 biovar eltor str. N16961 | ||
| Vibrio vulnificus CMCP6 | ||
| Vibrio harveyi ATCC BAA-1116 | ||
| Vibrio parahaemolyticus RIMD 2210633 | ||
| Vibrio shilonii AK1 | 4 | 1 |
| Vibrio splendidus LGP32 | ||
| Vibrio fischeri ES114 | ||
| Vibrio salmonicida LFI1238 | ||
| Vibrio angustum S14 | ||
| Photobacterium profundum SS9 | 4 | 1 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| xdhA |
|
|
|
|
*
Vibrio shilonii AK1 Site: position = -86 score = 4.93679 sequence = AGTTGACCTCTTGGTCAAAT Site: position = -58 score = 6.03515 sequence = TATTGACCCAAAGGTCAGAA Gene: VSAK1_25090: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4) |
|
|
|
|
*
Photobacterium profundum SS9 Site: position = -47 score = 5.92876 sequence = TATTGACTCAAAGGTCAGAA Site: position = -74 score = 5.61122 sequence = AGTTGACTAAAAAGTCAGCT Gene: PBPRA2243: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4) |
Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4) |
| xdhB |
|
|
|
|
Gene: VSAK1_25085: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4) |
|
|
|
|
Gene: PBPRA2244: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4) |
Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4) |
| xdhC |
|
|
|
|
Gene: VSAK1_25080: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase) |
|
|
|
|
Gene: PBPRA2245: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase) |
XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase) |
| guaD |
|
|
|
|
Gene: VSAK1_25075: Guanine deaminase (EC 3.5.4.3) |
|
|
|
|
Gene: PBPRA2246: Guanine deaminase (EC 3.5.4.3) |
Guanine deaminase (EC 3.5.4.3) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |