Regulon of XylR in Sinorhizobium meliloti 1021

Properties
Regulator type:	Transcription factor
TF locus tag:	SMb20901
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Xylose utilization
Effector:	Xylose
Regulog:	XylR - Rhizobiales
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By trascription factor - XylR
By taxonomy - Rhizobiales
By TF family - ROK
By effector - Xylose
By pathway - Xylose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -293 Score: 5.5 Sequence: TTTTTCTCGACAGTCGAGAAAAT Locus tag: SMb20901 Name: xylR Funciton: Xylose repressor XylR, ROK family
	SMb20901	xylR	Xylose repressor XylR, ROK family
Position: -115 Score: 5.5 Sequence: ATTTTCTCGACTGTCGAGAAAAA Locus tag: SMb20902 Name: xylF Funciton: Xylose ABC transporter, periplasmic xylose-binding protein XylF Locus tag: SMb20903 Name: xylH Funciton: Xylose ABC transporter, permease protein XylH Locus tag: SMb20904 Name: xylG Funciton: Xylose ABC transporter, ATP-binding protein XylG
	SMb20902	xylF	Xylose ABC transporter, periplasmic xylose-binding protein XylF
	SMb20903	xylH	Xylose ABC transporter, permease protein XylH
	SMb20904	xylG	Xylose ABC transporter, ATP-binding protein XylG

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD