Regulon of XylR in Rhizobium sp. NGR234

Properties
Regulator type:	Transcription factor
TF locus tag:	NGR_c24210
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Xylose utilization
Effector:	Xylose
Regulog:	XylR - Rhizobiales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By trascription factor - XylR
By taxonomy - Rhizobiales
By TF family - ROK
By effector - Xylose
By pathway - Xylose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -126 Score: 5.5 Sequence: ATTTTCTCGACTGTCGAGAAAAA Locus tag: NGR_c24220 Name: xylF Funciton: Xylose ABC transporter, periplasmic xylose-binding protein XylF
	NGR_c24220	xylF	Xylose ABC transporter, periplasmic xylose-binding protein XylF

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD