Regulon of XylR in Rhizobium sp. NGR234
| Regulator type: | Transcription factor |
| TF locus tag: | NGR_c24210 |
| Regulator family: | ROK |
| Regulation mode: | repressor |
| Biological process: | Xylose utilization |
| Effector: | Xylose |
| Regulog: | XylR - Rhizobiales |
| Statistics of regulated genes: | |
| - Genes | 1 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - XylR
- By taxonomy - Rhizobiales
- By TF family - ROK
- By effector - Xylose
- By pathway - Xylose utilization
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -126
Score: 5.5 Sequence: ATTTTCTCGACTGTCGAGAAAAA
Locus tag: NGR_c24220
Name: xylF Funciton: Xylose ABC transporter, periplasmic xylose-binding protein XylF |
|||
|
xylF
|
Xylose ABC transporter, periplasmic xylose-binding protein XylF
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |