Regulon of LexA in Photobacterium profundum SS9

Properties
Regulator type:	Transcription factor
TF locus tag:	PBPRA0165
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Vibrionales
Statistics of regulated genes:
- Genes	16
- Operons	12
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 186 sites [see more]

Member of regulog collections

By trascription factor - LexA
By taxonomy - Vibrionales
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -68 Score: 5.4 Sequence: TGCTGGACATTTATCCAGTA Locus tag: PBPRA0115 Name: rmuC Funciton: DNA recombination protein RmuC
	PBPRA0115	rmuC	DNA recombination protein RmuC
Position: -64 Score: 5.6 Sequence: TACTGTACGTAGATACAGTA Position: -42 Score: 5.4 Sequence: TACTGTATGAAAACACAGGT Locus tag: PBPRA0694 Name: recN Funciton: DNA repair protein RecN
	PBPRA0694	recN	DNA repair protein RecN
Position: -78 Score: 4.4 Sequence: TACTGTGTTTATATCCATGC Locus tag: PBPRA0566 Name: xerD Funciton: Site-specific recombinase XerD Locus tag: PBPRA0567 Name: dsbC Funciton: Thiol:disulfide interchange protein Locus tag: PBPRA0568 Name: recJ Funciton: Single-stranded-DNA-specific exonuclease RecJ (EC 3.1.-.-)
	PBPRA0566	xerD	Site-specific recombinase XerD
	PBPRA0567	dsbC	Thiol:disulfide interchange protein
	PBPRA0568	recJ	Single-stranded-DNA-specific exonuclease RecJ (EC 3.1.-.-)
Position: -4 Score: 5.4 Sequence: AACTGTGCATACATACAGTG Locus tag: PBPRB0973 Name: umuD Funciton: DNA polymerase V, subunit UmuD Locus tag: PBPRB0972 Name: umuC Funciton: DNA polymerase V, subunit UmuC
	PBPRB0973	umuD	DNA polymerase V, subunit UmuD
	PBPRB0972	umuC	DNA polymerase V, subunit UmuC
Position: -64 Score: 6.1 Sequence: TACTGTATATAAAAACAGTT Locus tag: PBPRA0832 Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7)
	PBPRA0832	dinB	DNA polymerase IV (EC 2.7.7.7)
Position: -64 Score: 5.7 Sequence: CACTGTATGAATAGACAGTA Locus tag: PBPRA3068 Name: recA Funciton: Recombinase A
	PBPRA3068	recA	Recombinase A
Position: -85 Score: 5.3 Sequence: CACTGGATATACTCACAGTA Position: -65 Score: 5.3 Sequence: GACTGTATAAACAAACAGGG Locus tag: PBPRA0165 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
	PBPRA0165	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
Position: -65 Score: 5 Sequence: TGCTGGATATCCATCCAGCA Locus tag: PBPRA1116 Name: ruvA Funciton: Holliday junction DNA helicase RuvA Locus tag: PBPRA1117 Name: ruvB Funciton: Holliday junction DNA helicase RuvB
	PBPRA1116	ruvA	Holliday junction DNA helicase RuvA
	PBPRA1117	ruvB	Holliday junction DNA helicase RuvB
Position: -91 Score: 5.4 Sequence: TACTGTATCTTTATACAGCA Locus tag: PBPRA3290 Name: uvrA Funciton: Excinuclease ABC subunit A
	PBPRA3290	uvrA	Excinuclease ABC subunit A
Position: -27 Score: 5.4 Sequence: CATTGTATAAATAACCAGTA Locus tag: PBPRA3513 Name: uvrD Funciton: ATP-dependent DNA helicase II
	PBPRA3513	uvrD	ATP-dependent DNA helicase II
Position: -38 Score: 5.5 Sequence: TACTGTATAAGCAGCCAGTA Locus tag: PBPRA3003 Name: yebG Funciton: SOS regulon DNA damage-inducible protein
	PBPRA3003	yebG	SOS regulon DNA damage-inducible protein
Position: -88 Score: 5.2 Sequence: AACTGTTGTTATATCCAGTA Locus tag: PBPRA2590 Name: topB Funciton: DNA topoisomerase III (EC 5.99.1.2)
	PBPRA2590	topB	DNA topoisomerase III (EC 5.99.1.2)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of LexA in Photobacterium profundum SS9

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --