Regulon of LexA in Vibrio cholerae O1 biovar eltor str. N16961

Properties
Regulator type:	Transcription factor
TF locus tag:	VC0092
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Vibrionales
Statistics of regulated genes:
- Genes	21
- Operons	17
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 186 sites [see more]

Member of regulog collections

By trascription factor - LexA
By taxonomy - Vibrionales
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -45 Score: 5 Sequence: CACTGGATATACTCACAGTC Position: -25 Score: 5.6 Sequence: AACTGTATAAAAAGACAGGT Locus tag: VC0092 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
	VC0092	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
Position: 69 Score: 5.4 Sequence: CACTGTACAAATCAACAGTA Locus tag: VC0543 Name: recA Funciton: Recombinase A Locus tag: VC0544 Name: recX Funciton: Regulatory protein RecX
	VC0543	recA	Recombinase A
	VC0544	recX	Regulatory protein RecX
Position: -66 Score: 6 Sequence: TACTGTATAAAGAAACAGTA Position: -44 Score: 6 Sequence: AACTGTTTAAACATACAGTA Position: -26 Score: 4.7 Sequence: TATTGGTTAATCATACAGGT Locus tag: VC0852 Name: recN Funciton: DNA repair protein RecN
	VC0852	recN	DNA repair protein RecN
Position: -30 Score: 5.8 Sequence: TACTGTTTATGTATACAGTA Locus tag: VC2287 Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7)
	VC2287	dinB	DNA polymerase IV (EC 2.7.7.7)
Position: -84 Score: 5.5 Sequence: TACTGGTTAAATTTACAGTT Locus tag: VC2043 Name: topB Funciton: DNA topoisomerase III (EC 5.99.1.2)
	VC2043	topB	DNA topoisomerase III (EC 5.99.1.2)
Position: -39 Score: 5.8 Sequence: TACTGTATTTACATACAGCA Locus tag: VC1191 Name: VC1191 Funciton: Superfamily II DNA and RNA helicase
	VC1191	VC1191	Superfamily II DNA and RNA helicase
Position: -40 Score: 5.9 Sequence: TACTGTACAAATAACCAGTT Locus tag: VCA0291 Name: intIA Funciton: Integron integrase IntI4
	VCA0291	intIA	Integron integrase IntI4
Position: -60 Score: 5.8 Sequence: AACTGTATTAAAAAACAGTA Position: -10 Score: 4.7 Sequence: TGCTGTAATTATGTACAGTG Locus tag: VC1368 Name: VC1368 Funciton: Conserved hypothetical protein
	VC1368	VC1368	Conserved hypothetical protein
Position: -65 Score: 5 Sequence: TCCTGTACAAAAACACAGCT Locus tag: VC2711 Name: recG Funciton: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
	VC2711	recG	ATP-dependent DNA helicase RecG (EC 3.6.1.-)
Position: -174 Score: 4.1 Sequence: TACTGTTTATTGATCCATAC Locus tag: VC0668 Name: mutH Funciton: DNA mismatch repair endonuclease MutH
	VC0668	mutH	DNA mismatch repair endonuclease MutH
Position: -56 Score: 5.5 Sequence: AACTGGACATTTATCCAGTG Locus tag: VC0082 Name: rmuC Funciton: DNA recombination protein RmuC
	VC0082	rmuC	DNA recombination protein RmuC
Position: -71 Score: 5.2 Sequence: TACTGGCTATCCATCCAGTT Locus tag: VC1846 Name: ruvA Funciton: Holliday junction DNA helicase RuvA Locus tag: VC1845 Name: ruvB Funciton: Holliday junction DNA helicase RuvB
	VC1846	ruvA	Holliday junction DNA helicase RuvA
	VC1845	ruvB	Holliday junction DNA helicase RuvB
Position: -85 Score: 5.7 Sequence: AACTGTTTTTTTATCCAGTA Locus tag: VC0394 Name: uvrA Funciton: Excinuclease ABC subunit A
	VC0394	uvrA	Excinuclease ABC subunit A
Position: -28 Score: 5.1 Sequence: TTATGTATAAATAACCAGTG Locus tag: VC0190 Name: uvrD Funciton: ATP-dependent DNA helicase II
	VC0190	uvrD	ATP-dependent DNA helicase II
Position: -49 Score: 5.9 Sequence: AACTGTATAAACAGCCAGTT Locus tag: VC2326 Name: yebG Funciton: SOS regulon DNA damage-inducible protein
	VC2326	yebG	SOS regulon DNA damage-inducible protein
Position: -89 Score: 4 Sequence: GGCTGTTTTTTTGTACATTA Locus tag: VC1463 Name: rstA Funciton: RstA phage-related replication protein Locus tag: VC1462 Name: rstB Funciton: RstB phage-related integrase
	VC1463	rstA	RstA phage-related replication protein
	VC1462	rstB	RstB phage-related integrase
Position: -89 Score: 4 Sequence: GGCTGTTTTTTTGTACATTA Locus tag: VC1454 Name: null Funciton: RstA phage-related replication protein Locus tag: VC1453 Name: null Funciton: RstB phage-related integrase
	VC1454		RstA phage-related replication protein
	VC1453		RstB phage-related integrase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of LexA in Vibrio cholerae O1 biovar eltor str. N16961

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --