Regulon of RbsR in Haemophilus parasuis SH0165

Properties
Regulator type:	Transcription factor
TF locus tag:	HAPS_1628
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Regulog:	RbsR - Pasteurellales
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By trascription factor - RbsR
By taxonomy - Pasteurellales
By TF family - LacI
By effector - Ribose
By pathway - Ribose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -40 Score: 6.3 Sequence: TCATCGAAACGTTTCGATGG Locus tag: HAPS_1629 Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) Locus tag: HAPS_1630 Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) Locus tag: HAPS_1631 Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) Locus tag: HAPS_1632 Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) Locus tag: HAPS_1633 Name: rbsK Funciton: Ribokinase (EC 2.7.1.15)
	HAPS_1629	rbsD	D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
	HAPS_1630	rbsA	Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
	HAPS_1631	rbsC	Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
	HAPS_1632	rbsB	Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
	HAPS_1633	rbsK	Ribokinase (EC 2.7.1.15)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD