Regulog RbsR - Pasteurellales

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By trascription factor - RbsR
By taxonomy - Pasteurellales
By TF family - LacI
By effector - Ribose
By pathway - Ribose utilization

Statistics of regulated genes
Genome	Genes	Operons
Haemophilus influenzae Rd KW20	6	1
Aggregatibacter aphrophilus NJ8700
Pasteurella multocida subsp. multocida str. Pm70	6	1
Mannheimia succiniciproducens MBEL55E
Actinobacillus succinogenes 130Z	6	1
Haemophilus somnus 2336	6	1
Actinobacillus pleuropneumoniae serovar 7 str. AP76	5	1
Haemophilus ducreyi 35000HP
Haemophilus parasuis SH0165	5	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes										Function

CRON 1.
rbsD	* Haemophilus influenzae Rd KW20 Site: position = -37 score = 6.03742 sequence = TTATCGAAACGTTTCGATAA Gene: HI0501: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)	Aggregatibacter aphrophilus NJ8700	* Pasteurella multocida subsp. multocida str. Pm70 Site: position = -46 score = 6.12927 sequence = TCATCGAAACGTTTCGATGA Gene: PM0156: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)	Mannheimia succiniciproducens MBEL55E	* Actinobacillus succinogenes 130Z Site: position = -51 score = 6.10058 sequence = TCATCGAAACGTTTCGATAA Gene: Asuc_0194: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)	* Haemophilus somnus 2336 Site: position = -72 score = 5.87731 sequence = TAATCGAAACGTTTCGATGA Gene: HSM_0089: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)	* Actinobacillus pleuropneumoniae serovar 7 str. AP76 Site: position = -48 score = 6.10058 sequence = TCATCGAAACGTTTCGATAA Gene: APP7_1729: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)	Haemophilus ducreyi 35000HP	* Haemophilus parasuis SH0165 Site: position = -40 score = 6.28167 sequence = TCATCGAAACGTTTCGATGG Gene: HAPS_1629: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)	D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
rbsA	Haemophilus influenzae Rd KW20 Gene: HI0502: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)	Aggregatibacter aphrophilus NJ8700	Pasteurella multocida subsp. multocida str. Pm70 Gene: PM0155: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)	Mannheimia succiniciproducens MBEL55E	Actinobacillus succinogenes 130Z Gene: Asuc_0195: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)	Haemophilus somnus 2336 Gene: HSM_0090: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_1730: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)	Haemophilus ducreyi 35000HP	Haemophilus parasuis SH0165 Gene: HAPS_1630: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)	Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
rbsC	Haemophilus influenzae Rd KW20 Gene: HI0503: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)	Aggregatibacter aphrophilus NJ8700	Pasteurella multocida subsp. multocida str. Pm70 Gene: PM0154: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)	Mannheimia succiniciproducens MBEL55E	Actinobacillus succinogenes 130Z Gene: Asuc_0196: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)	Haemophilus somnus 2336 Gene: HSM_0091: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_1731: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)	Haemophilus ducreyi 35000HP	Haemophilus parasuis SH0165 Gene: HAPS_1631: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)	Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
rbsB	Haemophilus influenzae Rd KW20 Gene: HI0504: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)	Aggregatibacter aphrophilus NJ8700	Pasteurella multocida subsp. multocida str. Pm70 Gene: PM0153: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)	Mannheimia succiniciproducens MBEL55E	Actinobacillus succinogenes 130Z Gene: Asuc_0197: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)	Haemophilus somnus 2336 Gene: HSM_0092: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_1732: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)	Haemophilus ducreyi 35000HP	Haemophilus parasuis SH0165 Gene: HAPS_1632: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)	Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
rbsK	Haemophilus influenzae Rd KW20 Gene: HI0505: Ribokinase (EC 2.7.1.15)	Aggregatibacter aphrophilus NJ8700 Gene: NT05HA_0080: Ribokinase (EC 2.7.1.15)	Pasteurella multocida subsp. multocida str. Pm70 Gene: PM0152: Ribokinase (EC 2.7.1.15)	Mannheimia succiniciproducens MBEL55E Gene: MS0283: Ribokinase (EC 2.7.1.15)	Actinobacillus succinogenes 130Z Gene: Asuc_0198: Ribokinase (EC 2.7.1.15)	Haemophilus somnus 2336 Gene: HSM_0093: Ribokinase (EC 2.7.1.15)	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_1733: Ribokinase (EC 2.7.1.15)	Haemophilus ducreyi 35000HP	Haemophilus parasuis SH0165 Gene: HAPS_1633: Ribokinase (EC 2.7.1.15)	Ribokinase (EC 2.7.1.15)
rbsR	Haemophilus influenzae Rd KW20 Gene: HI0506: Transcriptional repressor of ribose utilization, LacI family	Aggregatibacter aphrophilus NJ8700	Pasteurella multocida subsp. multocida str. Pm70 Gene: PM0151: Transcriptional repressor of ribose utilization, LacI family	Mannheimia succiniciproducens MBEL55E Gene: MS0284: Transcriptional repressor of ribose utilization, LacI family	Actinobacillus succinogenes 130Z Gene: Asuc_0199: Transcriptional repressor of ribose utilization, LacI family	Haemophilus somnus 2336 Gene: HSM_0094: Transcriptional repressor of ribose utilization, LacI family	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_1728: Transcriptional repressor of ribose utilization, LacI family	Haemophilus ducreyi 35000HP	Haemophilus parasuis SH0165 Gene: HAPS_1628: Transcriptional repressor of ribose utilization, LacI family	Transcriptional repressor of ribose utilization, LacI family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog RbsR - Pasteurellales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --