Regulog RbsR - Pasteurellales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Ribose utilization |
| Effector: | Ribose |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - RbsR
- By taxonomy - Pasteurellales
- By TF family - LacI
- By effector - Ribose
- By pathway - Ribose utilization
| Genome | Genes | Operons |
|---|---|---|
| Haemophilus influenzae Rd KW20 | 6 | 1 |
| Aggregatibacter aphrophilus NJ8700 | ||
| Pasteurella multocida subsp. multocida str. Pm70 | 6 | 1 |
| Mannheimia succiniciproducens MBEL55E | ||
| Actinobacillus succinogenes 130Z | 6 | 1 |
| Haemophilus somnus 2336 | 6 | 1 |
| Actinobacillus pleuropneumoniae serovar 7 str. AP76 | 5 | 1 |
| Haemophilus ducreyi 35000HP | ||
| Haemophilus parasuis SH0165 | 5 | 1 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| rbsD |
*
Haemophilus influenzae Rd KW20 Site: position = -37 score = 6.03742 sequence = TTATCGAAACGTTTCGATAA Gene: HI0501: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
|
*
Pasteurella multocida subsp. multocida str. Pm70 Site: position = -46 score = 6.12927 sequence = TCATCGAAACGTTTCGATGA Gene: PM0156: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
|
*
Actinobacillus succinogenes 130Z Site: position = -51 score = 6.10058 sequence = TCATCGAAACGTTTCGATAA Gene: Asuc_0194: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
*
Haemophilus somnus 2336 Site: position = -72 score = 5.87731 sequence = TAATCGAAACGTTTCGATGA Gene: HSM_0089: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
*
Actinobacillus pleuropneumoniae serovar 7 str. AP76 Site: position = -48 score = 6.10058 sequence = TCATCGAAACGTTTCGATAA Gene: APP7_1729: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
|
*
Haemophilus parasuis SH0165 Site: position = -40 score = 6.28167 sequence = TCATCGAAACGTTTCGATGG Gene: HAPS_1629: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
| rbsA |
Gene: HI0502: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
|
Gene: PM0155: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
|
Gene: Asuc_0195: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Gene: HSM_0090: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Gene: APP7_1730: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
|
Gene: HAPS_1630: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
| rbsC |
Gene: HI0503: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
|
Gene: PM0154: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
|
Gene: Asuc_0196: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
Gene: HSM_0091: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
Gene: APP7_1731: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
|
Gene: HAPS_1631: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
| rbsB |
Gene: HI0504: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
|
Gene: PM0153: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
|
Gene: Asuc_0197: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
Gene: HSM_0092: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
Gene: APP7_1732: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
|
Gene: HAPS_1632: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
| rbsK |
Gene: HI0505: Ribokinase (EC 2.7.1.15) |
Gene: NT05HA_0080: Ribokinase (EC 2.7.1.15) |
Gene: PM0152: Ribokinase (EC 2.7.1.15) |
Gene: MS0283: Ribokinase (EC 2.7.1.15) |
Gene: Asuc_0198: Ribokinase (EC 2.7.1.15) |
Gene: HSM_0093: Ribokinase (EC 2.7.1.15) |
Gene: APP7_1733: Ribokinase (EC 2.7.1.15) |
|
Gene: HAPS_1633: Ribokinase (EC 2.7.1.15) |
Ribokinase (EC 2.7.1.15) |
| rbsR |
Gene: HI0506: Transcriptional repressor of ribose utilization, LacI family |
|
Gene: PM0151: Transcriptional repressor of ribose utilization, LacI family |
Gene: MS0284: Transcriptional repressor of ribose utilization, LacI family |
Gene: Asuc_0199: Transcriptional repressor of ribose utilization, LacI family |
Gene: HSM_0094: Transcriptional repressor of ribose utilization, LacI family |
Gene: APP7_1728: Transcriptional repressor of ribose utilization, LacI family |
|
Gene: HAPS_1628: Transcriptional repressor of ribose utilization, LacI family |
Transcriptional repressor of ribose utilization, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |