Regulon of IscR in Caulobacter crescentus CB15

Properties
Regulator type:	Transcription factor
TF locus tag:	CC1866
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Caulobacterales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Caulobacterales
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -128 Score: 8.4 Sequence: ATACTTGACCGCCGCGCTTGGTCTT Locus tag: CC1866 Name: iscR Funciton: Iron-sulfur cluster regulator IscR
	CC1866	iscR	Iron-sulfur cluster regulator IscR

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD