Regulon of Zur in Photobacterium profundum SS9

Properties
Regulator type:	Transcription factor
TF locus tag:	PBPRA3326
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Vibrionales
Statistics of regulated genes:
- Genes	10
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 62 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -55 Score: 6 Sequence: GTGATGTTATAATATAACACCTT Locus tag: PBPRA1054 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: PBPRA1053 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	PBPRA1054	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	PBPRA1053	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: 24 Score: 5.6 Sequence: AAGGTGTTATATTATAACATCAC Locus tag: PBPRA1055 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: PBPRA1056 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	PBPRA1055	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	PBPRA1056	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -25 Score: 6.2 Sequence: GTAATGTTATATTATTACATTAC Locus tag: PBPRA0375 Name: VC2551 Funciton: hypothetical protein Locus tag: PBPRA0374 Name: zbp Funciton: Predicted zinc-binding protein
	PBPRA0375	VC2551	hypothetical protein
	PBPRA0374	zbp	Predicted zinc-binding protein
Position: -376 Score: 6.2 Sequence: GTAATGTTATATTATTACATTAC Locus tag: PBPRA0374 Name: zbp Funciton: Predicted zinc-binding protein Locus tag: PBPRA0373 Name: VV1_0719 Funciton: ABC-type antimicrobial peptide transport system, ATPase component Locus tag: PBPRA0372 Name: VC2554 Funciton: ABC-type antimicrobial peptide transport system, permease component Locus tag: PBPRA0371 Name: VC2555 Funciton: FIG003461: hypothetical protein
	PBPRA0374	zbp	Predicted zinc-binding protein
	PBPRA0373	VV1_0719	ABC-type antimicrobial peptide transport system, ATPase component
	PBPRA0372	VC2554	ABC-type antimicrobial peptide transport system, permease component
	PBPRA0371	VC2555	FIG003461: hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD