Regulon of Zur in Vibrio angustum S14

Properties
Regulator type:	Transcription factor
TF locus tag:	VAS14_18719
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Vibrionales
Statistics of regulated genes:
- Genes	6
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 62 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -43 Score: 6.6 Sequence: GTTATGTTATAACATAACAATAA Locus tag: VAS14_13584 Name: rpmE2 Funciton: LSU ribosomal protein L31p Locus tag: VAS14_13579 Name: rpmJ2 Funciton: LSU ribosomal protein L36p
	VAS14_13584	rpmE2	LSU ribosomal protein L31p
	VAS14_13579	rpmJ2	LSU ribosomal protein L36p
Position: -260 Score: 6.2 Sequence: GATGTGTTATAATATAACATATT Locus tag: VAS14_03723 Name: ribA Funciton: GTP cyclohydrolase II (EC 3.5.4.25)
	VAS14_03723	ribA	GTP cyclohydrolase II (EC 3.5.4.25)
Position: -133 Score: 6.8 Sequence: GTAATGTTATAATATAACATTAC Position: -109 Score: 6.5 Sequence: GATATGTTATATTGTAACATTAT Locus tag: VAS14_17786 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	VAS14_17786	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -83 Score: 6.3 Sequence: ATAATGTTACAATATAACATATC Position: -59 Score: 6.7 Sequence: GTAATGTTATATTATAACATTAC Locus tag: VAS14_17781 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: VAS14_17776 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	VAS14_17781	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	VAS14_17776	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD