Regulon of Zur in Vibrio fischeri ES114

Properties
Regulator type:	Transcription factor
TF locus tag:	VF_0306
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Vibrionales
Statistics of regulated genes:
- Genes	11
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 62 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -50 Score: 6.6 Sequence: AAAATGTTACATTATAACACTTA Locus tag: VF_0829 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: VF_0828 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	VF_0829	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	VF_0828	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -90 Score: 6.7 Sequence: GTTATGTTATAACATAACAATTA Locus tag: VF_2367 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: VF_2368 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	VF_2367	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	VF_2368	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -389 Score: 6.4 Sequence: AAAATGTTATATTATTACATTTA Locus tag: VF_0328 Name: zbp Funciton: Predicted zinc-binding protein
	VF_0328	zbp	Predicted zinc-binding protein
Position: -61 Score: 6.5 Sequence: TAAGTGTTATAATGTAACATTTT Locus tag: VF_0830 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	VF_0830	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -79 Score: 6.7 Sequence: GTTATGTTATAACATAACAATTA Locus tag: VF_2366 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	VF_2366	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -389 Score: 6.4 Sequence: AAAATGTTATATTATTACATTTA Locus tag: VF_0328 Name: zbp Funciton: Predicted zinc-binding protein Locus tag: VF_0327 Name: VV1_0719 Funciton: ABC-type antimicrobial peptide transport system, ATPase component Locus tag: VF_0326 Name: VC2554 Funciton: ABC-type antimicrobial peptide transport system, permease component Locus tag: VF_0325 Name: VC2555 Funciton: FIG003461: hypothetical protein
	VF_0328	zbp	Predicted zinc-binding protein
	VF_0327	VV1_0719	ABC-type antimicrobial peptide transport system, ATPase component
	VF_0326	VC2554	ABC-type antimicrobial peptide transport system, permease component
	VF_0325	VC2555	FIG003461: hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD