Regulon of Zur in Vibrio splendidus LGP32

Properties
Regulator type:	Transcription factor
TF locus tag:	VS_0290
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Vibrionales
Statistics of regulated genes:
- Genes	11
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 62 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -43 Score: 5.6 Sequence: GATATGTTATAACGTATCAAATT Locus tag: VS_2366 Name: rpmE2 Funciton: LSU ribosomal protein L31p
	VS_2366	rpmE2	LSU ribosomal protein L31p
Position: -116 Score: 6.7 Sequence: TAATTGTTATAATATAACAATTT Locus tag: VS_1924 Name: ribA Funciton: GTP cyclohydrolase II (EC 3.5.4.25)
	VS_1924	ribA	GTP cyclohydrolase II (EC 3.5.4.25)
Position: -60 Score: 6.5 Sequence: CTAATGTTATAATGTAACATTTA Locus tag: VS_2237 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	VS_2237	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -53 Score: 6.2 Sequence: ATATTGTTATATTATAACAGTAT Locus tag: VS_2780 Name: VC2551 Funciton: hypothetical protein Locus tag: VS_2781 Name: zbp Funciton: Predicted zinc-binding protein
	VS_2780	VC2551	hypothetical protein
	VS_2781	zbp	Predicted zinc-binding protein
Position: -46 Score: 6.4 Sequence: TAAATGTTACATTATAACATTAG Locus tag: VS_2238 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: VS_2239 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	VS_2238	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	VS_2239	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -385 Score: 6.2 Sequence: ATATTGTTATATTATAACAGTAT Locus tag: VS_2781 Name: zbp Funciton: Predicted zinc-binding protein Locus tag: VS_2782 Name: VV1_0719 Funciton: ABC-type antimicrobial peptide transport system, ATPase component Locus tag: VS_2783 Name: VC2554 Funciton: ABC-type antimicrobial peptide transport system, permease component Locus tag: VS_2784 Name: VC2555 Funciton: FIG003461: hypothetical protein
	VS_2781	zbp	Predicted zinc-binding protein
	VS_2782	VV1_0719	ABC-type antimicrobial peptide transport system, ATPase component
	VS_2783	VC2554	ABC-type antimicrobial peptide transport system, permease component
	VS_2784	VC2555	FIG003461: hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD