Regulon of Zur in Vibrio shilonii AK1

Properties
Regulator type:	Transcription factor
TF locus tag:	VSAK1_17587, VSAK1_13846
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Vibrionales
Statistics of regulated genes:
- Genes	14
- Operons	8
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 62 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -46 Score: 6.6 Sequence: GAAATGTTACATTATAACAATAA Locus tag: VSAK1_08973 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: VSAK1_08968 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	VSAK1_08973	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	VSAK1_08968	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -102 Score: 6.3 Sequence: GTTATGTTATAACATAACTTTTA Locus tag: VSAK1_17572 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: VSAK1_17577 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	VSAK1_17572	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	VSAK1_17577	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -31 Score: 6.5 Sequence: GCAATGTTATAACATAACAATTA Locus tag: VSAK1_20814 Name: rpmE2 Funciton: LSU ribosomal protein L31p Locus tag: VSAK1_20809 Name: rpmJ2 Funciton: LSU ribosomal protein L36p
	VSAK1_20814	rpmE2	LSU ribosomal protein L31p
	VSAK1_20809	rpmJ2	LSU ribosomal protein L36p
Position: -91 Score: 6.6 Sequence: TAATTGTTATAATATAACAATTA Locus tag: VSAK1_04575 Name: ribA Funciton: GTP cyclohydrolase II (EC 3.5.4.25)
	VSAK1_04575	ribA	GTP cyclohydrolase II (EC 3.5.4.25)
Position: -58 Score: 6.4 Sequence: TTATTGTTATAATGTAACATTTC Locus tag: VSAK1_08978 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	VSAK1_08978	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -64 Score: 6.5 Sequence: GTTATGTTATAACATAACAATTG Locus tag: VSAK1_17567 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	VSAK1_17567	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -391 Score: 5.9 Sequence: GATTTGTTATAACATAACAAATC Locus tag: VSAK1_01829 Name: zbp Funciton: Predicted zinc-binding protein
	VSAK1_01829	zbp	Predicted zinc-binding protein
Position: -391 Score: 5.9 Sequence: GATTTGTTATAACATAACAAATC Locus tag: VSAK1_01829 Name: zbp Funciton: Predicted zinc-binding protein Locus tag: VSAK1_01824 Name: VV1_0719 Funciton: ABC-type antimicrobial peptide transport system, ATPase component Locus tag: VSAK1_01819 Name: VC2554 Funciton: ABC-type antimicrobial peptide transport system, permease component Locus tag: VSAK1_01814 Name: VC2555 Funciton: FIG003461: hypothetical protein
	VSAK1_01829	zbp	Predicted zinc-binding protein
	VSAK1_01824	VV1_0719	ABC-type antimicrobial peptide transport system, ATPase component
	VSAK1_01819	VC2554	ABC-type antimicrobial peptide transport system, permease component
	VSAK1_01814	VC2555	FIG003461: hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Zur in Vibrio shilonii AK1

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --