Regulon of Zur in Vibrio parahaemolyticus RIMD 2210633

Properties
Regulator type:	Transcription factor
TF locus tag:	VP2729
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Vibrionales
Statistics of regulated genes:
- Genes	16
- Operons	7
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 62 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -43 Score: 5.3 Sequence: TGAGTGTTATATTATAACACCCG Locus tag: VP0303 Name: VC2551 Funciton: hypothetical protein Locus tag: VP0302 Name: zbp Funciton: Predicted zinc-binding protein
	VP0303	VC2551	hypothetical protein
	VP0302	zbp	Predicted zinc-binding protein
Position: -41 Score: 6.9 Sequence: AAAATGTTATAACATAACAATTT Locus tag: VP2331 Name: rpmE2 Funciton: LSU ribosomal protein L31p Locus tag: VP2330 Name: rpmJ2 Funciton: LSU ribosomal protein L36p
	VP2331	rpmE2	LSU ribosomal protein L31p
	VP2330	rpmJ2	LSU ribosomal protein L36p
Position: -55 Score: 6.8 Sequence: ATAATGTTATAATGTAACATTAT Locus tag: VP0853 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	VP0853	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -46 Score: 6.7 Sequence: ATAATGTTACATTATAACATTAT Locus tag: VP0852 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: VP0851 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	VP0852	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	VP0851	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -207 Score: 6.2 Sequence: AAATTGTTATACTATAACAATTT Locus tag: VP1921 Name: ribA Funciton: GTP cyclohydrolase II (EC 3.5.4.25)
	VP1921	ribA	GTP cyclohydrolase II (EC 3.5.4.25)
Position: -62 Score: 6.2 Sequence: TAATTGTTATATTATAACAACTT Position: -33 Score: 6.3 Sequence: CATATGTTATAACATAACAATAA Locus tag: VPA1308 Name: omr Funciton: predicted zinc-related TonB-dependent outer membrane transporter Locus tag: VPA1307 Name: znuA2 Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: VPA1306 Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	VPA1308	omr	predicted zinc-related TonB-dependent outer membrane transporter
	VPA1307	znuA2	Zinc ABC transporter, periplasmic-binding protein ZnuA
	VPA1306	znuB2	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -43 Score: 5.3 Sequence: TGAGTGTTATATTATAACACCCG Locus tag: VP0303 Name: VC2551 Funciton: hypothetical protein Locus tag: VP0302 Name: zbp Funciton: Predicted zinc-binding protein Locus tag: VP0301 Name: VV1_0719 Funciton: ABC-type antimicrobial peptide transport system, ATPase component Locus tag: VP0300 Name: VC2554 Funciton: ABC-type antimicrobial peptide transport system, permease component Locus tag: VP0299 Name: VC2555 Funciton: FIG003461: hypothetical protein
	VP0303	VC2551	hypothetical protein
	VP0302	zbp	Predicted zinc-binding protein
	VP0301	VV1_0719	ABC-type antimicrobial peptide transport system, ATPase component
	VP0300	VC2554	ABC-type antimicrobial peptide transport system, permease component
	VP0299	VC2555	FIG003461: hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Zur in Vibrio parahaemolyticus RIMD 2210633

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --