Regulon of Zur in Vibrio harveyi ATCC BAA-1116

Properties
Regulator type:	Transcription factor
TF locus tag:	VIBHAR_06414, VIBHAR_00010
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Vibrionales
Statistics of regulated genes:
- Genes	9
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 62 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -41 Score: 6.6 Sequence: ATAATGTTATAACATAACAATCA Locus tag: VIBHAR_03250 Name: rpmE2 Funciton: LSU ribosomal protein L31p Locus tag: VIBHAR_03249 Name: rpmJ2 Funciton: LSU ribosomal protein L36p
	VIBHAR_03250	rpmE2	LSU ribosomal protein L31p
	VIBHAR_03249	rpmJ2	LSU ribosomal protein L36p
Position: -154 Score: 6.6 Sequence: TAAATGTTATATTATAACAATTG Locus tag: VIBHAR_02717 Name: ribA Funciton: GTP cyclohydrolase II (EC 3.5.4.25)
	VIBHAR_02717	ribA	GTP cyclohydrolase II (EC 3.5.4.25)
Position: -55 Score: 6.8 Sequence: ATAATGTTATAATGTAACATTAT Locus tag: VIBHAR_01361 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	VIBHAR_01361	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -46 Score: 6.7 Sequence: ATAATGTTACATTATAACATTAT Locus tag: VIBHAR_01360 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: VIBHAR_01359 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	VIBHAR_01360	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	VIBHAR_01359	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -70 Score: 5.3 Sequence: TCTTTGTTATGTTATAACATCTG Position: -36 Score: 4.8 Sequence: GTGGTGTAATAACATAACAAAGT Locus tag: VIBHAR_06466 Name: omr Funciton: predicted zinc-related TonB-dependent outer membrane transporter Locus tag: VIBHAR_06465 Name: znuA2 Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: VIBHAR_06464 Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	VIBHAR_06466	omr	predicted zinc-related TonB-dependent outer membrane transporter
	VIBHAR_06465	znuA2	Zinc ABC transporter, periplasmic-binding protein ZnuA
	VIBHAR_06464	znuB2	Zinc ABC transporter, inner membrane permease protein ZnuB

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD