Regulon of Zur in Vibrio vulnificus CMCP6

Properties
Regulator type:	Transcription factor
TF locus tag:
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Vibrionales
Statistics of regulated genes:
- Genes	13
- Operons	7
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 62 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -125 Score: 6.7 Sequence: GAAATGTTATAACATAACATTTG Locus tag: VV1_0360 Name: omr Funciton: predicted zinc-related TonB-dependent outer membrane transporter Locus tag: VV1_0359 Name: znuA2 Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: VV1_0358 Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	VV1_0360	omr	predicted zinc-related TonB-dependent outer membrane transporter
	VV1_0359	znuA2	Zinc ABC transporter, periplasmic-binding protein ZnuA
	VV1_0358	znuB2	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -37 Score: 6.7 Sequence: AATATGTTATAACATAACAATTA Locus tag: VV1_1840 Name: rpmE2 Funciton: LSU ribosomal protein L31p
	VV1_1840	rpmE2	LSU ribosomal protein L31p
Position: -144 Score: 6.1 Sequence: TTATTGTTATAATATAACAAAAC Locus tag: VV1_2234 Name: ribA Funciton: GTP cyclohydrolase II (EC 3.5.4.25)
	VV1_2234	ribA	GTP cyclohydrolase II (EC 3.5.4.25)
Position: -58 Score: 6.3 Sequence: TGAGTGTTATAATGTAACATTTT Locus tag: VV1_0151 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	VV1_0151	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -381 Score: 5.6 Sequence: TAGCTGTTATATTGTAACACTTT Locus tag: VV1_0717 Name: zbp Funciton: Predicted zinc-binding protein
	VV1_0717	zbp	Predicted zinc-binding protein
Position: -46 Score: 6.3 Sequence: AAAATGTTACATTATAACACTCA Locus tag: VV1_0152 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: VV1_0153 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	VV1_0152	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	VV1_0153	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -381 Score: 5.6 Sequence: TAGCTGTTATATTGTAACACTTT Locus tag: VV1_0717 Name: zbp Funciton: Predicted zinc-binding protein Locus tag: VV1_0719 Name: VV1_0719 Funciton: ABC-type antimicrobial peptide transport system, ATPase component Locus tag: VV1_0720 Name: VC2554 Funciton: ABC-type antimicrobial peptide transport system, permease component Locus tag: VV1_0721 Name: VC2555 Funciton: FIG003461: hypothetical protein
	VV1_0717	zbp	Predicted zinc-binding protein
	VV1_0719	VV1_0719	ABC-type antimicrobial peptide transport system, ATPase component
	VV1_0720	VC2554	ABC-type antimicrobial peptide transport system, permease component
	VV1_0721	VC2555	FIG003461: hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Zur in Vibrio vulnificus CMCP6

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --